Regulon of Zur in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VC0378
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Vibrionales
Statistics of regulated genes:
- Genes	13
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 62 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 5.5 Sequence: TGAATGTTACTTTATAACATAAC Locus tag: VC2082 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: VC2083 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	VC2082	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	VC2083	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -97 Score: 6.2 Sequence: CATTTGTTATAACATAACAATTT Locus tag: VC1263 Name: ribA Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
	VC1263	ribA	GTP cyclohydrolase II (EC 3.5.4.25)
Position: -40 Score: 6.9 Sequence: AAAATGTTATAACATAACAATTT Locus tag: VC0878 Name: rpmE2 Funciton: LSU ribosomal protein L31p Locus tag: VC0879 Name: rpmJ2 Funciton: LSU ribosomal protein L36p
	VC0878	rpmE2	LSU ribosomal protein L31p
	VC0879	rpmJ2	LSU ribosomal protein L36p
Position: -50 Score: 5.9 Sequence: GTTATGTTATAAAGTAACATTCA Locus tag: VC2081 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
	VC2081	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
Position: -50 Score: 5.1 Sequence: GACTTGTTATATTATAACAAGCC Locus tag: VC2551 Name: VC2551 Funciton: hypothetical protein Locus tag: VC2552 Name: zbp Funciton: Predicted zinc-binding protein
	VC2551	VC2551	hypothetical protein
	VC2552	zbp	Predicted zinc-binding protein
Position: -50 Score: 5.1 Sequence: GACTTGTTATATTATAACAAGCC Locus tag: VC2551 Name: VC2551 Funciton: hypothetical protein Locus tag: VC2552 Name: zbp Funciton: Predicted zinc-binding protein Locus tag: VC2553 Name: VV1_0719 Funciton: ABC-type antimicrobial peptide transport system, ATPase component Locus tag: VC2554 Name: VC2554 Funciton: ABC-type antimicrobial peptide transport system, permease component Locus tag: VC2555 Name: VC2555 Funciton: FIG003461: hypothetical protein
	VC2551	VC2551	hypothetical protein
	VC2552	zbp	Predicted zinc-binding protein
	VC2553	VV1_0719	ABC-type antimicrobial peptide transport system, ATPase component
	VC2554	VC2554	ABC-type antimicrobial peptide transport system, permease component
	VC2555	VC2555	FIG003461: hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD