Regulon of SahR in Gluconacetobacter diazotrophicus PAl 5

Properties
Regulator type:	Transcription factor
TF locus tag:	Gdia_0808
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Methionine metabolism
Effector:	S-adenosylhomocysteine
Regulog:	SahR - Rhodospirillales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - SahR/SamR
By TF family - ArsR
By effector - S-adenosylhomocysteine
By pathway - Methionine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -30 Score: 5.1 Sequence: ATATAAGGATGTTGTTATAT Locus tag: Gdia_0808 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family Locus tag: Gdia_0809 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	Gdia_0808	sahR	Transcriptional regulator of methionine metabolism, ArsR family
	Gdia_0809	metF	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
Position: -366 Score: 5.1 Sequence: ATATAACAACATCCTTATAT Locus tag: Gdia_0807 Name: metE Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
	Gdia_0807	metE	5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD