Regulon of SahR in Azospirillum sp. B510

Properties
Regulator type:	Transcription factor
TF locus tag:	AZL_009180
Regulator family:	ArsR
Regulation mode:	repressor
Biological process:	Methionine metabolism
Effector:	S-adenosylhomocysteine
Regulog:	SahR - Rhodospirillales
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 17 sites [see more]

Member of regulog collections

By taxonomy - Rhodospirillales
By trascription factor - SahR/SamR
By TF family - ArsR
By effector - S-adenosylhomocysteine
By pathway - Methionine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -60 Score: 6.8 Sequence: GCATAAAGATATCTTTATAT Locus tag: AZL_009180 Name: sahR Funciton: Transcriptional regulator of methionine metabolism, ArsR family Locus tag: AZL_009190 Name: metF Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20) Locus tag: AZL_009200 Name: null Funciton: hypothetical protein Locus tag: AZL_009210 Name: null Funciton: hypothetical protein Locus tag: AZL_009220 Name: metH Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
	AZL_009180	sahR	Transcriptional regulator of methionine metabolism, ArsR family
	AZL_009190	metF	5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
	AZL_009200		hypothetical protein
	AZL_009210		hypothetical protein
	AZL_009220	metH	5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Position: -134 Score: 6.6 Sequence: ACATAAAGATATCTTTATGC Locus tag: AZL_026520 Name: ahcY Funciton: Adenosylhomocysteinase (EC 3.3.1.1)
	AZL_026520	ahcY	Adenosylhomocysteinase (EC 3.3.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD