Regulon of NsrR in Caulobacter sp. K31

Properties
Regulator type:	Transcription factor
TF locus tag:	Caul_0854
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Caulobacterales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By trascription factor - NsrR
By taxonomy - Caulobacterales
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -34 Score: 4.9 Sequence: AGATGCATTTGATAAGCATCA Locus tag: Caul_0855 Name: PF09313 Funciton: Truncated hemoglobins Locus tag: Caul_0856 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	Caul_0855	PF09313	Truncated hemoglobins
	Caul_0856	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
Position: -109 Score: 4.9 Sequence: TGATGCTTATCAAATGCATCT Locus tag: Caul_0854 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR
	Caul_0854	nsrR	Nitrite-sensitive transcriptional repressor NsrR

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD