Regulog NsrR - Caulobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Caulobacter crescentus CB15
Caulobacter segnis ATCC 21756
Caulobacter sp. K31	3	2
Phenylobacterium zucineum HLK1	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
coxA	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	Caulobacter sp. K31	* Phenylobacterium zucineum HLK1 Site: position = -41 score = 2.71495 sequence = AGATGTATCCCCGATATATCT Gene: PHZ_c3176: Cytochrome c oxidase polypeptide I (EC 1.9.3.1)	Cytochrome c oxidase polypeptide I (EC 1.9.3.1)
nsrR	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -109 score = 4.89943 sequence = TGATGCTTATCAAATGCATCT Gene: Caul_0854: Nitrite-sensitive transcriptional repressor NsrR	Phenylobacterium zucineum HLK1 Gene: PHZ_c3177: Nitrite-sensitive transcriptional repressor NsrR	Nitrite-sensitive transcriptional repressor NsrR

CRON 2.
PF09313	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	* Caulobacter sp. K31 Site: position = -34 score = 4.89943 sequence = AGATGCATTTGATAAGCATCA Gene: Caul_0855: Truncated hemoglobins	Phenylobacterium zucineum HLK1	Truncated hemoglobins
hmp	Caulobacter crescentus CB15	Caulobacter segnis ATCC 21756	Caulobacter sp. K31 Gene: Caul_0856: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)	Phenylobacterium zucineum HLK1	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --