Regulon of NsrR in Psychromonas ingrahamii 37

Properties
Regulator type:	Transcription factor
TF locus tag:	Ping_0631
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Nitrosative stress response
Effector:	Nitric oxide
Regulog:	NsrR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Psychromonadaceae/Aeromonadales
By trascription factor - NsrR
By TF family - Rrf2
By effector - Nitric oxide
By pathway - Nitrosative stress response

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.2 Sequence: AGATGTAAAATAAATACATCT Locus tag: Ping_0631 Name: nsrR Funciton: Nitrite-sensitive transcriptional repressor NsrR Locus tag: Ping_0630 Name: nnrS Funciton: NnrS protein involved in response to NO
	Ping_0631	nsrR	Nitrite-sensitive transcriptional repressor NsrR
	Ping_0630	nnrS	NnrS protein involved in response to NO
Position: -63 Score: 4.2 Sequence: ATATGCATTTAAGATGCCTCT Position: -33 Score: 4.5 Sequence: AGAAGTATTTTAAATGCATAT Locus tag: Ping_2905 Name: hmp Funciton: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)
	Ping_2905	hmp	Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD