Regulog NsrR - Psychromonadaceae/Aeromonadales
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - NsrR
- By TF family - Rrf2
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
| Genome | Genes | Operons |
|---|---|---|
| Psychromonas ingrahamii 37 | 3 | 2 |
| Psychromonas sp. CNPT3 | 2 | 2 |
| Moritella sp. PE36 | ||
| Aeromonas hydrophila subsp. hydrophila ATCC 7966 | ||
| Aeromonas salmonicida subsp. salmonicida A449 | ||
| Tolumonas auensis DSM 9187 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| nsrR |
*
Psychromonas ingrahamii 37 Site: position = -49 score = 5.22459 sequence = AGATGTAAAATAAATACATCT Gene: Ping_0631: Nitrite-sensitive transcriptional repressor NsrR |
*
Psychromonas sp. CNPT3 Site: position = -86 score = 5.00719 sequence = AGTTGCATTTAAAATACATGT Gene: PCNPT3_03591: Nitrite-sensitive transcriptional repressor NsrR |
Gene: PE36_21894: Nitrite-sensitive transcriptional repressor NsrR |
2
Aeromonas hydrophila subsp. hydrophila ATCC 7966 Gene: AHA_0250: Nitrite-sensitive transcriptional repressor NsrR Gene: AHA_0662: Nitrite-sensitive transcriptional repressor NsrR |
2
Aeromonas salmonicida subsp. salmonicida A449 Gene: ASA_4148: Nitrite-sensitive transcriptional repressor NsrR Gene: ASA_0662: Nitrite-sensitive transcriptional repressor NsrR |
2
Tolumonas auensis DSM 9187 Gene: Tola_0148: Nitrite-sensitive transcriptional repressor NsrR Gene: Tola_1822: Nitrite-sensitive transcriptional repressor NsrR |
Nitrite-sensitive transcriptional repressor NsrR |
| nnrS |
Gene: Ping_0630: NnrS protein involved in response to NO |
Gene: PCNPT3_11823: NnrS protein involved in response to NO |
Gene: PE36_13469: NnrS protein involved in response to NO |
Gene: AHA_3945: NnrS protein involved in response to NO |
|
|
NnrS protein involved in response to NO |
| CRON 2. | |||||||
| hmp |
*
Psychromonas ingrahamii 37 Site: position = -63 score = 4.24931 sequence = ATATGCATTTAAGATGCCTCT Site: position = -33 score = 4.45857 sequence = AGAAGTATTTTAAATGCATAT Gene: Ping_2905: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
*
Psychromonas sp. CNPT3 Site: position = -36 score = 5.00719 sequence = ACATGTATTTTAAATGCAACT Gene: PCNPT3_03586: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
Gene: PE36_10688: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
Gene: AHA_0661: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
Gene: ASA_0661: Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
|
Flavohemoprotein (Hemoglobin-like protein) (Flavohemoglobin) (Nitric oxide dioxygenase) (EC 1.14.12.17) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |