Profile of regulator NsrR in Psychromonadaceae/Aeromonadales
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Nitrosative stress response |
| Effector: | Nitric oxide |
| Regulog: | NsrR - Psychromonadaceae/Aeromonadales |
Member of regulog collections
- By taxonomy - Psychromonadaceae/Aeromonadales
- By trascription factor - NsrR
- By TF family - Rrf2
- By effector - Nitric oxide
- By pathway - Nitrosative stress response
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Psychromonas ingrahamii 37 | |||||
| Ping_0631 | nsrR | -49 | 5.2 | AGATGTAAAATAAATACATCT | |
| Ping_2905 | hmp | -63 | 4.2 | ATATGCATTTAAGATGCCTCT | |
| Ping_2905 | hmp | -33 | 4.5 | AGAAGTATTTTAAATGCATAT | |
| Psychromonas sp. CNPT3 | |||||
| PCNPT3_03586 | hmp | -36 | 5 | ACATGTATTTTAAATGCAACT | |
| PCNPT3_03591 | nsrR | -86 | 5 | AGTTGCATTTAAAATACATGT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |