Regulon of Zur in Corynebacterium urealyticum DSM 7109

Properties
Regulator type:	Transcription factor
TF locus tag:	cur_1324
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Corynebacteriaceae
Statistics of regulated genes:
- Genes	12
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 5.3 Sequence: TAATGGAAAACAGTGCCATTA Locus tag: cur_1147 Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein Locus tag: cur_1146 Name: mntB Funciton: putative manganese ABC transporter, ATP-binding protein Locus tag: cur_1145 Name: mntC Funciton: putative manganese ABC transporter, permease component Locus tag: cur_1144 Name: mntD Funciton: putative manganese ABC transporter, permease component 2
	cur_1147	mntA	putative manganese ABC transporter, substrate-binding protein
	cur_1146	mntB	putative manganese ABC transporter, ATP-binding protein
	cur_1145	mntC	putative manganese ABC transporter, permease component
	cur_1144	mntD	putative manganese ABC transporter, permease component 2
Position: -98 Score: 4.8 Sequence: TAATGGGAACTATACTCATTA Locus tag: cur_1829 Name: adhA Funciton: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
	cur_1829	adhA	Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
Position: -160 Score: 5.1 Sequence: AAAGGAAAACCATTGCCAATT Position: -103 Score: 5 Sequence: ACTTGAAAATGGCTGTCATTA Locus tag: cur_0291 Name: sapD Funciton: putative surface-anchored protein Locus tag: cur_0292 Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: cur_0293 Name: DIP0440 Funciton: putative ABC transport system, ATP-binding protein Locus tag: cur_0294 Name: DIP0441 Funciton: putative ABC transport system, permease protein
	cur_0291	sapD	putative surface-anchored protein
	cur_0292	troA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	cur_0293	DIP0440	putative ABC transport system, ATP-binding protein
	cur_0294	DIP0441	putative ABC transport system, permease protein
Position: -43 Score: 5.1 Sequence: TATTGCAATCTGTTCCCATTA Locus tag: cur_1662 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: cur_1663 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: cur_1664 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	cur_1662	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	cur_1663	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	cur_1664	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD