Regulon of Zur in Corynebacterium kroppenstedtii DSM 44385

Properties
Regulator type:	Transcription factor
TF locus tag:	ckrop_1315
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Corynebacteriaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -38 Score: 5.1 Sequence: AATTGACATCATATTTCATTA Locus tag: ckrop_0347 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: ckrop_0346 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: ckrop_0345 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	ckrop_0347	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	ckrop_0346	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	ckrop_0345	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -164 Score: 5.1 Sequence: TATTGACATTGTGTATCATTA Locus tag: ckrop_1235 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	ckrop_1235	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD