Regulon of Zur in Corynebacterium jeikeium K411

Properties
Regulator type:	Transcription factor
TF locus tag:	jk0612
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Corynebacteriaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 4.4 Sequence: GTTTGAAAATGGTTGCCACTT Position: -42 Score: 4.2 Sequence: TAATGAAAACTAGACTCATTG Locus tag: jk1856 Name: sapD Funciton: putative surface-anchored protein Locus tag: jk1855 Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: jk1854 Name: DIP0439 Funciton: Putative membrane protein Locus tag: jk1853 Name: DIP0440 Funciton: putative ABC transport system, ATP-binding protein Locus tag: jk1852 Name: DIP0441 Funciton: putative ABC transport system, permease protein
	jk1856	sapD	putative surface-anchored protein
	jk1855	troA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	jk1854	DIP0439	Putative membrane protein
	jk1853	DIP0440	putative ABC transport system, ATP-binding protein
	jk1852	DIP0441	putative ABC transport system, permease protein
Position: 40 Score: 5 Sequence: TgAaGAAAATGgTTgcCAaTt Locus tag: jk0328 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: jk0327 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: jk0326 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	jk0328	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	jk0327	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	jk0326	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -40 Score: 5.2 Sequence: TGATGAAAACAGGTTGCAATA Locus tag: jk1292 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	jk1292	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD