Regulon of Zur in Corynebacterium glutamicum ATCC 13032

Properties
Regulator type:	Transcription factor
TF locus tag:	cg2502
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Corynebacteriaceae
Statistics of regulated genes:
- Genes	10
- Operons	7
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -25 Score: 5.9 Sequence: AAATGATAACCGTTATCATTA Locus tag: cg0043 Name: znuC2 Funciton: zinc ABC transporter, ATP-binding protein
	cg0043	znuC2	zinc ABC transporter, ATP-binding protein
Position: -105 Score: 5.3 Sequence: TTTTGGGAATCATTTTCAATA Position: -60 Score: 6.1 Sequence: TAATGGAAATTGTTTTCAATA Locus tag: cg0795 Name: null Funciton: FAD-dependent pyridine nucleotide-disulphide oxidoreductase
	cg0795		FAD-dependent pyridine nucleotide-disulphide oxidoreductase
Position: -40 Score: 5.3 Sequence: TATTGACAAAGAGTGCCATTA Position: 4 Score: 5.3 Sequence: TACTGAAAGACATTTTCAATA Locus tag: cg0041 Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein Locus tag: cg0040 Name: cg0040 Funciton: putative secreted protein
	cg0041	mntA	putative manganese ABC transporter, substrate-binding protein
	cg0040	cg0040	putative secreted protein
Position: -317 Score: 5.7 Sequence: AATTGAAAAACATTTCCATTA Locus tag: cg3107 Name: adhA Funciton: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
	cg3107	adhA	Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
Position: -25 Score: 5.9 Sequence: TAATGATAACGGTTATCATTT Position: -19 Score: 4.2 Sequence: TAACGGTTATCATTTTCAAAT Locus tag: cg0042 Name: DIP0441 Funciton: putative ABC transport system, permease protein
	cg0042	DIP0441	putative ABC transport system, permease protein
Position: -38 Score: 5.4 Sequence: TGTTGACATCCTTTTTCAATA Locus tag: cg2911 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: cg2912 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: cg2913 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	cg2911	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	cg2912	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	cg2913	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -79 Score: 6.1 Sequence: TATTGAAAACAATTTCCATTA Position: -34 Score: 5.3 Sequence: TATTGAAAATGATTCCCAAAA Locus tag: cg0794 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	cg0794	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD