Regulon of Zur in Corynebacterium diphtheriae NCTC 13129

Properties
Regulator type:	Transcription factor
TF locus tag:	DIP1710
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Corynebacteriaceae
Statistics of regulated genes:
- Genes	10
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -2 Score: 5.3 Sequence: TAATGAAAATAATTACCGATA Locus tag: DIP2325 Name: cmra Funciton: putative surface-anchored protein
	DIP2325	cmra	putative surface-anchored protein
Position: -37 Score: 5.5 Sequence: TATTGAAAATAGGTACCATTA Locus tag: DIP2114 Name: adhA Funciton: Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
	DIP2114	adhA	Zn-dependent alcohol dehydrogenase( EC:1.1.1.1 )
Position: -84 Score: 5 Sequence: TATTGGTTATCTTTTTCATTT Locus tag: DIP0442 Name: null Funciton: Putative membrane protein Locus tag: DIP0443 Name: sapD Funciton: putative surface-anchored protein
	DIP0442		Putative membrane protein
	DIP0443	sapD	putative surface-anchored protein
Position: -69 Score: 4.9 Sequence: TAATGAAAATGATTGTGATGT Locus tag: DIP0438 Name: troA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: DIP0439 Name: DIP0439 Funciton: Putative membrane protein Locus tag: DIP0440 Name: DIP0440 Funciton: putative ABC transport system, ATP-binding protein Locus tag: DIP0441 Name: DIP0441 Funciton: putative ABC transport system, permease protein
	DIP0438	troA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	DIP0439	DIP0439	Putative membrane protein
	DIP0440	DIP0440	putative ABC transport system, ATP-binding protein
	DIP0441	DIP0441	putative ABC transport system, permease protein
Position: -25 Score: 5.1 Sequence: AAGTGAAAACGGTATCCATTA Locus tag: DIP1486 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	DIP1486	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Position: -68 Score: 5.2 Sequence: AATTGACATCGGATTCCAATA Position: -30 Score: 4.4 Sequence: AATTGCAAATCTAAATCAATA Locus tag: DIP1724 Name: sapD Funciton: putative surface-anchored protein
	DIP1724	sapD	putative surface-anchored protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD