Regulon of Zur in Corynebacterium amycolatum SK46

Properties
Regulator type:	Transcription factor
TF locus tag:	CORAM0001_1534
Regulator family:	FUR
Regulation mode:	repressor
Biological process:	Zinc homeostasis
Effector:	Zinc ion, (Zn2+)
Regulog:	Zur - Corynebacteriaceae
Statistics of regulated genes:
- Genes	9
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 38 sites [see more]

Member of regulog collections

By taxonomy - Corynebacteriaceae
By trascription factor - Zur
By TF family - FUR
By effector - Zinc ion, (Zn2+)
By pathway - Zinc homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -143 Score: 4.4 Sequence: GGTTGAAAATGCTTGTCGTTA Locus tag: CORAM0001_0534 Name: mntA Funciton: putative manganese ABC transporter, substrate-binding protein Locus tag: CORAM0001_0535 Name: mntB Funciton: putative manganese ABC transporter, ATP-binding protein Locus tag: CORAM0001_0536 Name: mntC Funciton: putative manganese ABC transporter, permease component Locus tag: CORAM0001_0537 Name: mntD Funciton: putative manganese ABC transporter, permease component 2 Locus tag: CORAM0001_0538 Name: mntR Funciton: Manganese-dependent transcriptional regulator MntR
	CORAM0001_0534	mntA	putative manganese ABC transporter, substrate-binding protein
	CORAM0001_0535	mntB	putative manganese ABC transporter, ATP-binding protein
	CORAM0001_0536	mntC	putative manganese ABC transporter, permease component
	CORAM0001_0537	mntD	putative manganese ABC transporter, permease component 2
	CORAM0001_0538	mntR	Manganese-dependent transcriptional regulator MntR
Position: -85 Score: 5.4 Sequence: AAAGGACAACTGTTTTCAATA Locus tag: CORAM0001_1250 Name: znuA Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA Locus tag: CORAM0001_1251 Name: znuC Funciton: Zinc ABC transporter, ATP-binding protein ZnuC Locus tag: CORAM0001_1252 Name: znuB Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
	CORAM0001_1250	znuA	Zinc ABC transporter, periplasmic-binding protein ZnuA
	CORAM0001_1251	znuC	Zinc ABC transporter, ATP-binding protein ZnuC
	CORAM0001_1252	znuB	Zinc ABC transporter, inner membrane permease protein ZnuB
Position: -36 Score: 5.4 Sequence: TATTGATAAGCATTTTCAGTA Locus tag: CORAM0001_0703 Name: yciC Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
	CORAM0001_0703	yciC	Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD