Regulon of TyrR in Aggregatibacter aphrophilus NJ8700

Properties
Regulator type:	Transcription factor
TF locus tag:	NT05HA_0604
Regulator family:	TyrR
Regulation mode:	activator (repressor)
Biological process:	Aromatic amino acid metabolism
Effector:	Tyrosine; Phenylalanine
Regulog:	TyrR - Pasteurellales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 29 sites [see more]

Member of regulog collections

By trascription factor - TyrR
By taxonomy - Pasteurellales
By TF family - TyrR
By effector - Tyrosine
By effector - Phenylalanine
By pathway - Aromatic amino acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -170 Score: 4.5 Sequence: ATTTAAATTAAATTTAACAA Locus tag: NT05HA_0124 Name: tpl Funciton: Tyrosine phenol-lyase (EC 4.1.99.2)
	NT05HA_0124	tpl	Tyrosine phenol-lyase (EC 4.1.99.2)
Position: -83 Score: 5.8 Sequence: CTGTAAATAAAAGTTGCCAA Locus tag: NT05HA_0604 Name: tyrR Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
	NT05HA_0604	tyrR	Transcriptional regulator of aromatic amino acid biosynthesis

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD