Regulog TyrR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | TyrR |
| Regulation mode: | activator (repressor) |
| Biological process: | Aromatic amino acid metabolism |
| Effector: | Tyrosine; Phenylalanine |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - TyrR
- By taxonomy - Pasteurellales
- By TF family - TyrR
- By effector - Tyrosine
- By effector - Phenylalanine
- By pathway - Aromatic amino acid metabolism
| Genome | Genes | Operons |
|---|---|---|
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | 5 | 3 |
| Actinobacillus succinogenes 130Z | 3 | 2 |
| Aggregatibacter aphrophilus NJ8700 | 2 | 2 |
| Haemophilus ducreyi 35000HP | 2 | 2 |
| Haemophilus influenzae Rd KW20 | 2 | 2 |
| Haemophilus parasuis SH0165 | 5 | 4 |
| Haemophilus somnus 2336 | 2 | 2 |
| Mannheimia succiniciproducens MBEL55E | 4 | 3 |
| Pasteurella multocida subsp. multocida str. Pm70 | 5 | 4 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| tyrR |
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -80 score = 6.08961 sequence = ATGTAAACAAAAGTTTCCAA Gene: APP7_0857: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Actinobacillus succinogenes 130Z Site: position = -80 score = 4.76612 sequence = GTGTAAAGATAAGTTGACGT Gene: Asuc_0958: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Aggregatibacter aphrophilus NJ8700 Site: position = -83 score = 5.80277 sequence = CTGTAAATAAAAGTTGCCAA Gene: NT05HA_0604: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Haemophilus ducreyi 35000HP Site: position = -80 score = 6.17206 sequence = TTGTAAACAAAAGTTTCCAA Gene: HD1229: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Haemophilus influenzae Rd KW20 Site: position = -74 score = 5.57627 sequence = ATGTAAAATAATATTTACAC Gene: HI0410: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Haemophilus parasuis SH0165 Site: position = -84 score = 6.14147 sequence = TTGTAAACAAAAATTTCCAA Gene: HAPS_1204: Transcriptional regulator of aromatic amino acid biosynthesis |
Gene: HSM_1076: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Mannheimia succiniciproducens MBEL55E Site: position = -30 score = 5.77219 sequence = ATGTAAATAAAAGTTGCCAT Gene: MS0762: Transcriptional regulator of aromatic amino acid biosynthesis |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -85 score = 5.31398 sequence = ATGTAAATTTATCTTTCCAG Gene: PM0908: Transcriptional regulator of aromatic amino acid biosynthesis |
Transcriptional regulator of aromatic amino acid biosynthesis |
| CRON 2. | ||||||||||
| aroF |
*
Actinobacillus pleuropneumoniae serovar 7 str. AP76 Site: position = -34 score = 5.41387 sequence = CTGTATTTAAAATTTTACAG Gene: APP7_0187: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Actinobacillus succinogenes 130Z Site: position = -41 score = 5.39517 sequence = TCGTACATAAAAATTTACAG Gene: Asuc_1570: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
|
*
Haemophilus ducreyi 35000HP Site: position = -32 score = 4.90415 sequence = ATGTATCAAAAATTTTACAC Gene: HD0444: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
|
*
Haemophilus parasuis SH0165 Site: position = -35 score = 4.78971 sequence = CTGTATTGATTTTTTTACAA Gene: HAPS_1274: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -47 score = 5.80679 sequence = ATGTACATATAAATTTACAT Gene: MS1104: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -86 score = 5.1255 sequence = ATGTAAATTATTTATTACAT Site: position = -63 score = 5.88659 sequence = GTGTATATAAATGTTTACAT Gene: PM0665: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54) |
| tyrA |
Gene: APP7_0186: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: Asuc_1569: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: NT05HA_0647: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
|
*
Haemophilus influenzae Rd KW20 Site: position = -43 score = 5.76188 sequence = TTGTAATTAATTTTTTACAA Site: position = -20 score = 4.84618 sequence = ATGTAAGATAAAAATTACAG Gene: HI1290: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: HAPS_1273: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
*
Haemophilus somnus 2336 Site: position = -57 score = 4.97445 sequence = TTGTAAGTTATTTTTTACAA Site: position = -34 score = 5.71976 sequence = TTGTAATAATAAATGTACAA Gene: HSM_1080: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: MS1102: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Gene: PM0664: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43) |
| CRON 3. | ||||||||||
| tyrP |
*2
Actinobacillus pleuropneumoniae serovar 7 str. AP76 Gene: APP7_0643: Tyrosine-specific transport protein Site: position = -97 score = 5.89377 sequence = GTGTAATAATATGTTTACAG Gene: APP7_0642: Tyrosine-specific transport protein |
Gene: Asuc_1489: Tyrosine-specific transport protein |
Gene: NT05HA_1757: Tyrosine-specific transport protein |
Gene: HD1499: Tyrosine-specific transport protein |
Gene: HI0528: Tyrosine-specific transport protein |
*2
Haemophilus parasuis SH0165 Site: position = -89 score = 5.59963 sequence = GTGTAATTATTTTTTTACAT Gene: HAPS_0525: Tyrosine-specific transport protein Site: position = -174 score = 5.16335 sequence = TTGTAAAAGAAAGTTTACTA Gene: HAPS_0526: Tyrosine-specific transport protein |
*2
Haemophilus somnus 2336 Gene: HSM_1583: Tyrosine-specific transport protein Site: position = -99 score = 5.65725 sequence = ATGTAAACATAATATTACAT Site: position = -78 score = 5.73058 sequence = TTGTAAAAATAAAATTACAC Gene: HSM_1247: Tyrosine-specific transport protein |
*
Mannheimia succiniciproducens MBEL55E Site: position = -40 score = 5.53246 sequence = CCGTAAAAAAATAATTACAT Gene: MS0977: Tyrosine-specific transport protein |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -101 score = 4.70836 sequence = CTGTAAAATAATAATAACAC Site: position = -82 score = 5.87135 sequence = CTGTAAAAAAATGGTTACAT Gene: PM0732: Tyrosine-specific transport protein |
Tyrosine-specific transport protein |
| CRON 4. | ||||||||||
| tpl |
|
|
*
Aggregatibacter aphrophilus NJ8700 Site: position = -170 score = 4.53762 sequence = ATTTAAATTAAATTTAACAA Gene: NT05HA_0124: Tyrosine phenol-lyase (EC 4.1.99.2) |
|
|
|
|
|
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -134 score = 5.97816 sequence = GTGTAAATAATAATTTACAA Gene: PM0811: Tyrosine phenol-lyase (EC 4.1.99.2) |
Tyrosine phenol-lyase (EC 4.1.99.2) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |