Regulon of DESPIG_02495 in Desulfovibrio piger ATCC 29098

Properties
Regulator type:	Transcription factor
TF locus tag:	DESPIG_02495
Regulator family:	ArsR
Regulation mode:
Biological process:
Effector:
Regulog:	DESPIG_02495 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 6.3 Sequence: TAAAACTATAAAACTAGTTTTT Position: -81 Score: 6.8 Sequence: TAAAACTAGTTTTTTAGTTGAC Position: -55 Score: 6.8 Sequence: TGAAACTACTTTTTTAGTTTGA Locus tag: DESPIG_02495 Name: null Funciton: transcriptional regulator, ArsR family Locus tag: DESPIG_02496 Name: null Funciton: MFS transporter, AMP-dependent synthetase/ligase
	DESPIG_02495		transcriptional regulator, ArsR family
	DESPIG_02496		MFS transporter, AMP-dependent synthetase/ligase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD