Profile of regulator DESPIG_02495 in Desulfovibrionales
| Regulator family: | ArsR |
| Regulation mode: | |
| Biological process: | |
| Effector: | |
| Regulog: | DESPIG_02495 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio piger ATCC 29098 | |||||
| DESPIG_02495 | null | -89 | 6.3 | TAAAACTATAAAACTAGTTTTT | |
| DESPIG_02495 | null | -81 | 6.8 | TAAAACTAGTTTTTTAGTTGAC | |
| DESPIG_02495 | null | -55 | 6.8 | TGAAACTACTTTTTTAGTTTGA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |