Regulog DESPIG_02495 - Desulfovibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:
Biological process:
Effector:
Phylum:	Proteobacteria/delta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Desulfovibrio piger ATCC 29098	2	1
Desulfovibrio salexigens DSM 2638
Desulfovibrio magneticus RS-1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028
Desulfohalobium retbaense DSM 5692

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
DESPIG_02495	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	* Desulfovibrio piger ATCC 29098 Site: position = -89 score = 6.28355 sequence = TAAAACTATAAAACTAGTTTTT Site: position = -81 score = 6.77936 sequence = TAAAACTAGTTTTTTAGTTGAC Site: position = -55 score = 6.77936 sequence = TGAAACTACTTTTTTAGTTTGA Gene: DESPIG_02495: transcriptional regulator, ArsR family	Desulfovibrio salexigens DSM 2638	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	transcriptional regulator, ArsR family
Dbac_1480	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	Desulfovibrio piger ATCC 29098 Gene: DESPIG_02496: MFS transporter, AMP-dependent synthetase/ligase	Desulfovibrio salexigens DSM 2638	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028 Gene: Dbac_1480: MFS transporter, AMP-dependent synthetase/ligase	Desulfohalobium retbaense DSM 5692	MFS transporter, AMP-dependent synthetase/ligase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --