Regulon of Ddes_1264 in Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774

Properties
Regulator type:	Transcription factor
TF locus tag:	Ddes_1264
Regulator family:	ArsR
Regulation mode:
Biological process:	Heavy metal resistance
Effector:
Regulog:	Ddes_1264 - Desulfovibrionales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Desulfovibrionales
By TF family - ArsR
By pathway - Heavy metal resistance

Regulated operons
	Locus Tag	Name	Function
Position: -177 Score: 7.4 Sequence: CATTTCGTCGCATGACGAAATA Position: -128 Score: 7.4 Sequence: TATTTCGTCAAAGAACGAAATA Locus tag: Ddes_1264 Name: null Funciton: transcriptional regulator, ArsR family Locus tag: Ddes_1265 Name: zntA Funciton: heavy metal translocating P-type ATPase
	Ddes_1264		transcriptional regulator, ArsR family
	Ddes_1265	zntA	heavy metal translocating P-type ATPase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD