Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator Ddes_1264 in Desulfovibrionales

Properties
Regulator family: ArsR
Regulation mode:
Biological process: Heavy metal resistance
Effector:
Regulog: Ddes_1264 - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774
Ddes_1264 null -128 7.4 TATTTCGTCAAAGAACGAAATA
Ddes_1264 null -177 7.4 CATTTCGTCGCATGACGAAATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD
© 2009-2020 RegPrecise