Profile of regulator Ddes_1264 in Desulfovibrionales
| Regulator family: | ArsR |
| Regulation mode: | |
| Biological process: | Heavy metal resistance |
| Effector: | |
| Regulog: | Ddes_1264 - Desulfovibrionales |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
- By pathway - Heavy metal resistance
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | |||||
| Ddes_1264 | null | -128 | 7.4 | TATTTCGTCAAAGAACGAAATA | |
| Ddes_1264 | null | -177 | 7.4 | CATTTCGTCGCATGACGAAATA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |