Regulog Ddes_1264 - Desulfovibrionales
| Regulator type: | Transcription factor |
| Regulator family: | ArsR |
| Regulation mode: | |
| Biological process: | Heavy metal resistance |
| Effector: | |
| Phylum: | Proteobacteria/delta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Desulfovibrionales
- By TF family - ArsR
- By pathway - Heavy metal resistance
| Genome | Genes | Operons |
|---|---|---|
| Desulfovibrio vulgaris Hildenborough | ||
| Desulfovibrio vulgaris str. Miyazaki F | ||
| Desulfovibrio desulfuricans G20 | ||
| Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 | 2 | 1 |
| Desulfovibrio piger ATCC 29098 | ||
| Desulfovibrio salexigens DSM 2638 | ||
| Desulfovibrio magneticus RS-1 | ||
| Lawsonia intracellularis PHE/MN1-00 | ||
| Desulfomicrobium baculatum DSM 4028 | ||
| Desulfohalobium retbaense DSM 5692 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| Ddes_1264 |
|
|
|
*
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Site: position = -128 score = 7.41796 sequence = TATTTCGTCAAAGAACGAAATA Site: position = -177 score = 7.41796 sequence = CATTTCGTCGCATGACGAAATA Gene: Ddes_1264: transcriptional regulator, ArsR family |
|
|
|
|
|
|
transcriptional regulator, ArsR family |
| zntA |
|
|
|
Gene: Ddes_1265: heavy metal translocating P-type ATPase |
|
|
|
Gene: LI0598: heavy metal translocating P-type ATPase |
|
|
heavy metal translocating P-type ATPase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |