Regulog Ddes_1264 - Desulfovibrionales

Properties
Regulator type:	Transcription factor
Regulator family:	ArsR
Regulation mode:
Biological process:	Heavy metal resistance
Effector:
Phylum:	Proteobacteria/delta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Desulfovibrio vulgaris Hildenborough
Desulfovibrio vulgaris str. Miyazaki F
Desulfovibrio desulfuricans G20
Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774	2	1
Desulfovibrio piger ATCC 29098
Desulfovibrio salexigens DSM 2638
Desulfovibrio magneticus RS-1
Lawsonia intracellularis PHE/MN1-00
Desulfomicrobium baculatum DSM 4028
Desulfohalobium retbaense DSM 5692

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes											Function

CRON 1.
Ddes_1264	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	* Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Site: position = -128 score = 7.41796 sequence = TATTTCGTCAAAGAACGAAATA Site: position = -177 score = 7.41796 sequence = CATTTCGTCGCATGACGAAATA Gene: Ddes_1264: transcriptional regulator, ArsR family	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	transcriptional regulator, ArsR family
zntA	Desulfovibrio vulgaris Hildenborough	Desulfovibrio vulgaris str. Miyazaki F	Desulfovibrio desulfuricans G20	Desulfovibrio desulfuricans subsp. desulfuricans str. ATCC 27774 Gene: Ddes_1265: heavy metal translocating P-type ATPase	Desulfovibrio piger ATCC 29098	Desulfovibrio salexigens DSM 2638	Desulfovibrio magneticus RS-1	Lawsonia intracellularis PHE/MN1-00 Gene: LI0598: heavy metal translocating P-type ATPase	Desulfomicrobium baculatum DSM 4028	Desulfohalobium retbaense DSM 5692	heavy metal translocating P-type ATPase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --