Regulog RbsR2 - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - RbsR
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 3 | 1 |
| Staphylococcus capitis SK14 | ||
| Staphylococcus epidermidis ATCC 12228 | 3 | 1 |
| Staphylococcus carnosus subsp. carnosus TM300 | 3 | 1 |
| Staphylococcus haemolyticus JCSC1435 | 6 | 1 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 5 | 2 |
| Macrococcus caseolyticus JCSC5402 | 4 | 1 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| rbsR2 |
|
|
|
|
*
Staphylococcus haemolyticus JCSC1435 Site: position = -33 score = 6.61836 sequence = TCATGTAAGCGGTTACATAA Gene: SH0174: Transcriptional repressor of ribose utilization RbsR2, LacI family |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -32 score = 6.43357 sequence = ATATGAAAACGGTTACATAA Gene: SSP1396: Transcriptional repressor of ribose utilization RbsR2, LacI family |
*
Macrococcus caseolyticus JCSC5402 Site: position = -36 score = 6.61836 sequence = TTATGTAATCGGTTACACAA Gene: MCCL_0348: Transcriptional repressor of ribose utilization RbsR2, LacI family |
Transcriptional repressor of ribose utilization RbsR2, LacI family |
| rbsK |
|
|
|
|
Gene: SH0175: Ribokinase (EC 2.7.1.15) |
Gene: SSP0744: Ribokinase (EC 2.7.1.15) |
Gene: MCCL_0349: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
| rbsD |
Gene: SA0259: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: STACA0001_0974: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: SE2087: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: Sca_2420: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
Gene: SH0176: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -35 score = 6.68713 sequence = TTATGTAACGGGTTACATAT Gene: SSP1395: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsA |
|
|
|
|
Gene: SH0177: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Gene: SSP1394: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
|
|
|
|
Gene: SH0178: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Gene: SSP1393: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
|
|
|
|
Gene: SH0179: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Gene: SSP1392: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| MCCL_0350 |
|
|
|
|
|
|
Gene: MCCL_0350: hypothetical protein |
hypothetical protein |
| MCCL_0351 |
|
|
|
|
|
|
Gene: MCCL_0351: hypothetical protein |
hypothetical protein |
| rbsU |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -88 score = 4.52793 sequence = TTATGAAAACGCATGCATTT Gene: SA0260: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
Gene: STACA0001_0973: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -270 score = 4.71616 sequence = GTAGGTAACCGTTAAAATAA Gene: SE2088: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -103 score = 5.42855 sequence = ATATGAAAGCGTATACATAT Gene: Sca_2421: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
|
|
|
Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) |
| rbsK |
Gene: SA0258: Ribokinase (EC 2.7.1.15) |
Gene: STACA0001_0975: Ribokinase (EC 2.7.1.15) |
Gene: SE2086: Ribokinase (EC 2.7.1.15) |
Gene: Sca_2419: Ribokinase (EC 2.7.1.15) |
|
|
|
Ribokinase (EC 2.7.1.15) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |