Regulon of RbsR2 in Staphylococcus carnosus subsp. carnosus TM300

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR2 - Staphylococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 5.4 Sequence: ATATGAAAGCGTATACATAT Locus tag: Sca_2421 Name: rbsU Funciton: Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5) Locus tag: Sca_2420 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: Sca_2419 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	Sca_2421	rbsU	Putative ribose uptake protein RbsU, GRP transporter family (TC 2.A.7.5)
	Sca_2420	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	Sca_2419	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD