Regulon of RbsR2 in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_0348
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR2 - Staphylococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - RbsR
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -36 Score: 6.6 Sequence: TTATGTAATCGGTTACACAA Locus tag: MCCL_0348 Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization RbsR2, LacI family Locus tag: MCCL_0349 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15) Locus tag: MCCL_0350 Name: null Funciton: hypothetical protein Locus tag: MCCL_0351 Name: null Funciton: hypothetical protein
	MCCL_0348	rbsR2	Transcriptional repressor of ribose utilization RbsR2, LacI family
	MCCL_0349	rbsK	Ribokinase (EC 2.7.1.15)
	MCCL_0350		hypothetical protein
	MCCL_0351		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD