Regulog IscR - Clostridia-2
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-2
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Clostridium bartlettii DSM 16795 | 4 | 1 |
| Clostridium difficile 630 | 3 | 1 |
| Clostridium hiranonis DSM 13275 | 4 | 1 |
| Genes | Function | |||
|---|---|---|---|---|
| CRON 1. | ||||
| iscR |
*
Clostridium bartlettii DSM 16795 Site: position = -88 score = 5.73843 sequence = TTAATGTTGACAAAAACACTCAAGTATAA Site: position = -113 score = 6.62147 sequence = TTAATTCTGACTAAAATAGTCAAAATTAA Gene: CLOBAR_02189: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium difficile 630 Site: position = -53 score = 5.38793 sequence = GTAATTCCTACTAAAACAGTATGAATTAG Site: position = -98 score = 5.95584 sequence = TTAATCTTGACAAAATTAGTAGGGTATAA Gene: CD1278: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium hiranonis DSM 13275 Site: position = -43 score = 6.01591 sequence = TTAAACCATAGTAAAACAGTAGGAATTAA Site: position = -77 score = 5.65314 sequence = TAATACTTGACAAAAATAGTCGGATATAA Site: position = -103 score = 5.88657 sequence = ACAAATCATACTAAAATAGTAGGAAATAA Gene: CLOHIR_01195: Iron-sulfur cluster assembly transcription factor IscR |
Iron-sulfur cluster assembly transcription factor IscR |
| iscS |
Gene: CLOBAR_02188: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CD1279: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CLOHIR_01196: Cysteine desulfurase (EC 2.8.1.7) |
Cysteine desulfurase (EC 2.8.1.7) |
| iscU |
Gene: CLOBAR_02187: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: CD1280: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: CLOHIR_01197: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
| trmU |
Gene: CLOBAR_02186: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: CD1281: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: CLOHIR_01198: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |