Regulon of IscR in Clostridium hiranonis DSM 13275

Properties
Regulator type:	Transcription factor
TF locus tag:	CLOHIR_01195
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Clostridia-2
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-2
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -103 Score: 5.9 Sequence: ACAAATCATACTAAAATAGTAGGAAATAA Position: -77 Score: 5.7 Sequence: TAATACTTGACAAAAATAGTCGGATATAA Position: -43 Score: 6 Sequence: TTAAACCATAGTAAAACAGTAGGAATTAA Locus tag: CLOHIR_01195 Name: iscR Funciton: Iron-sulfur cluster assembly transcription factor IscR Locus tag: CLOHIR_01196 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: CLOHIR_01197 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like Locus tag: CLOHIR_01198 Name: trmU Funciton: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
	CLOHIR_01195	iscR	Iron-sulfur cluster assembly transcription factor IscR
	CLOHIR_01196	iscS	Cysteine desulfurase (EC 2.8.1.7)
	CLOHIR_01197	iscU	Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
	CLOHIR_01198	trmU	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD