Regulog AraR - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Arabinose utilization |
| Effector: | Arabinose |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - GntR/Others
- By effector - Arabinose
- By pathway - Arabinose utilization
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | 14 | 7 |
| Clostridium beijerincki NCIMB 8052 | 14 | 6 |
| Clostridium botulinum A str. ATCC 3502 | ||
| Clostridium butyricum 5521 | ||
| Clostridium kluyveri DSM 555 | ||
| Clostridium novyi NT | ||
| Clostridium perfringens ATCC 13124 | ||
| Clostridium tetani E88 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| araJ |
|
*
Clostridium beijerincki NCIMB 8052 Site: position = -267 score = 4.90972 sequence = TTTCATGTATGTACAAGTAT Site: position = -234 score = 4.85152 sequence = AAAATTGTACATACAATTAT Gene: Cbei_4464: Predicted arabinose response two-component system sensor histidine kinase |
|
|
|
|
|
|
Predicted arabinose response two-component system sensor histidine kinase |
| araI |
|
Gene: Cbei_4463: Predicted arabinose response two-component system sensor histidine kinase/response regulator hybrid |
|
|
|
|
|
|
Predicted arabinose response two-component system sensor histidine kinase/response regulator hybrid |
| CRON 2. | |||||||||
| Cbei_4461 |
|
*
Clostridium beijerincki NCIMB 8052 Site: position = -52 score = 4.9091 sequence = GATGTGGTACGTACATGTTT Gene: Cbei_4461: Putative arabinose-regulated ABC transport system, ATP-binding protein |
|
|
|
|
|
|
Putative arabinose-regulated ABC transport system, ATP-binding protein |
| Cbei_4460 |
|
Gene: Cbei_4460: Putative arabinose-regulated ABC transport system, permease protein |
|
|
|
|
|
|
Putative arabinose-regulated ABC transport system, permease protein |
| Cbei_4459 |
|
Gene: Cbei_4459: Putative arabinose-regulated ABC transport system, permease protein |
|
|
|
|
|
|
Putative arabinose-regulated ABC transport system, permease protein |
| CRON 3. | |||||||||
| Cbei_4451 |
|
*
Clostridium beijerincki NCIMB 8052 Site: position = -135 score = 4.41148 sequence = ATTGATGTACTTACAAGATA Site: position = -310 score = 4.40344 sequence = CATGAAGTACGTACAACATA Gene: Cbei_4451: hypothetical protein |
|
|
|
|
|
|
hypothetical protein |
| araF |
|
Gene: Cbei_4450: L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2) |
|
|
|
|
|
|
L-arabinose-binding periplasmic protein precursor AraF (TC 3.A.1.2.2) |
| araG |
|
Gene: Cbei_4449: L-arabinose transport, ATP binding protein |
|
|
|
|
|
|
L-arabinose transport, ATP binding protein |
| araH |
|
Gene: Cbei_4448: L-arabinose transport system permease protein (TC 3.A.1.2.2) |
|
|
|
|
|
|
L-arabinose transport system permease protein (TC 3.A.1.2.2) |
| CRON 4. | |||||||||
| abf3 |
*
Clostridium acetobutylicum ATCC 824 Site: position = -300 score = 4.47139 sequence = ATATTTATACGTGTTAATTT Site: position = -228 score = 3.90833 sequence = CATTTTATGGGTATATAATA Gene: CAC3436: Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
|
|
|
|
|
|
|
Alpha-N-arabinofuranosidase (EC 3.2.1.55) |
| CRON 5. | |||||||||
| araE |
*
Clostridium acetobutylicum ATCC 824 Site: position = -215 score = 4.64203 sequence = CAATTCATACGTATAAAATC Site: position = -182 score = 4.37719 sequence = ACATTTATACACATAAATAT Gene: CAC1339: Arabinose-proton symporter |
|
|
|
|
|
|
|
Arabinose-proton symporter |
| CRON 6. | |||||||||
| arb43 |
*
Clostridium acetobutylicum ATCC 824 Site: position = -201 score = 5.72461 sequence = AAATTTATACGTATAAATTA Site: position = -60 score = 5.34058 sequence = TAATATGTACGTATATATTA Gene: CAC1529: Alpha-L-arabinofuranosidase II precursor (EC 3.2.1.55) |
|
|
|
|
|
|
|
Alpha-L-arabinofuranosidase II precursor (EC 3.2.1.55) |
| araT |
Gene: CAC1530: putative arabinoside transporter |
|
|
|
|
|
|
|
putative arabinoside transporter |
| CRON 7. | |||||||||
| ptk |
*
Clostridium acetobutylicum ATCC 824 Site: position = -154 score = 4.58233 sequence = TGACATATGCGTACAAATAT Site: position = -186 score = 5.82682 sequence = AAATTTATACGTACAAATTA Gene: CAC1343: Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
|
|
|
|
|
|
|
Xylulose-5-phosphate phosphoketolase (EC 4.1.2.9) |
| CRON 8. | |||||||||
| araK |
*
Clostridium acetobutylicum ATCC 824 Site: position = -103 score = 4.89418 sequence = AAATAGGTACGTACCATTTT Site: position = -72 score = 4.46492 sequence = TGACATGTACGTACAAAAGT Gene: CAC1344: novel Ribulokinase (EC 2.7.1.16) |
Gene: Cbei_4452: novel Ribulokinase (EC 2.7.1.16) |
|
|
|
|
|
|
novel Ribulokinase (EC 2.7.1.16) |
| araE/xylT |
Gene: CAC1345: Arabinose-proton symporter |
|
|
|
|
|
|
|
Arabinose-proton symporter |
| araA |
2
Clostridium acetobutylicum ATCC 824 Gene: CAC1342: L-arabinose isomerase (EC 5.3.1.4) Gene: CAC1346: L-arabinose isomerase (EC 5.3.1.4) |
*
Clostridium beijerincki NCIMB 8052 Site: position = -260 score = 5.07202 sequence = CATCTTGTATGTACAACATT Site: position = -227 score = 4.64442 sequence = AAGCTTGTACATACATCAAA Gene: Cbei_4457: L-arabinose isomerase (EC 5.3.1.4) |
|
|
|
|
|
|
L-arabinose isomerase (EC 5.3.1.4) |
| tal |
Gene: CAC1347: Transaldolase (EC 2.2.1.2) |
Gene: Cbei_4454: Transaldolase (EC 2.2.1.2) |
|
|
|
|
|
|
Transaldolase (EC 2.2.1.2) |
| tkt |
Gene: CAC1348: Transketolase (EC 2.2.1.1) |
Gene: Cbei_4453: Transketolase (EC 2.2.1.1) |
|
|
|
|
|
|
Transketolase (EC 2.2.1.1) |
| epiA |
Gene: CAC1349: L-arabinose-specific 1-epimerase (mutarotase) |
*
Clostridium beijerincki NCIMB 8052 Site: position = -123 score = 4.85152 sequence = ATAATTGTATGTACAATTTT Site: position = -90 score = 4.90972 sequence = ATACTTGTACATACATGAAA Gene: Cbei_4465: L-arabinose-specific 1-epimerase (mutarotase) |
|
|
|
|
|
|
L-arabinose-specific 1-epimerase (mutarotase) |
| araR |
*
Clostridium acetobutylicum ATCC 824 Site: position = -246 score = 4.59459 sequence = TAATTTGTACTTATAAATGT Site: position = -88 score = 5.32082 sequence = AAATTTATACGTATCAATAT Site: position = -215 score = 4.65115 sequence = ATTTTCATACGTATAAATTC Gene: CAC1340: Transcriptional repressor of arabinoside utilization operon, GntR family |
*
Clostridium beijerincki NCIMB 8052 Site: position = -99 score = 4.45698 sequence = CATCAAGTGCGTACAACTTT Gene: Cbei_4456: Transcriptional repressor of arabinoside utilization operon, GntR family |
|
|
|
|
|
|
Transcriptional repressor of arabinoside utilization operon, GntR family |
| araD |
*
Clostridium acetobutylicum ATCC 824 Site: position = -430 score = 5.32082 sequence = ATATTGATACGTATAAATTT Site: position = -272 score = 4.59459 sequence = ACATTTATAAGTACAAATTA Site: position = -303 score = 4.65115 sequence = GAATTTATACGTATGAAAAT Gene: CAC1341: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Gene: Cbei_4455: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
|
|
|
|
|
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |