Regulog PaaR - Various betaproteobacteria
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Phenylacetic acid degradation |
| Effector: | Phenylacetyl-CoA |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Various betaproteobacteria
- By TF family - TetR
- By effector - Phenylacetyl-CoA
- By pathway - Phenylacetic acid degradation
| Genome | Genes | Operons |
|---|---|---|
| Methylobacillus flagellatus KT | ||
| Methylophilales bacterium HTCC2181 | ||
| Methylotenera mobilis JLW8 | ||
| Nitrosomonas europaea ATCC 19718 | ||
| Nitrosospira multiformis ATCC 25196 | ||
| Thiobacillus denitrificans | ||
| Azoarcus sp. EbN1 | 12 | 2 |
| Dechloromonas aromatica RCB | ||
| Thauera sp. MZ1T | 2 | 2 |
| Chromobacterium violaceum ATCC 12472 | ||
| Laribacter hongkongensis HLHK9 | ||
| Neisseria meningitidis MC58 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| paaG |
|
|
|
|
|
|
*
Azoarcus sp. EbN1 Site: position = -115 score = 5.5897 sequence = ATTGATTGACCGGTCGGTCAAA Gene: ebA3542: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Daro_0371: Enoyl-CoA hydratase (EC 4.2.1.17) |
Gene: Tmz1t_1512: Enoyl-CoA hydratase (EC 4.2.1.17) |
|
|
|
Enoyl-CoA hydratase (EC 4.2.1.17) |
| paaH |
|
|
|
|
|
|
Gene: ebA3543: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: Daro_0372: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
Gene: Tmz1t_1511: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
|
|
|
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) |
| paaI |
|
|
|
|
|
|
Gene: ebA3544: Phenylacetic acid degradation protein paaI |
Gene: Daro_0373: Phenylacetic acid degradation protein paaI |
Gene: Tmz1t_1510: Phenylacetic acid degradation protein paaI |
|
|
|
Phenylacetic acid degradation protein paaI |
| paaK |
|
|
|
|
|
|
Gene: ebA3545: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Daro_0374: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
Gene: Tmz1t_1509: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
|
|
|
Phenylacetate-coenzyme A ligase (EC 6.2.1.30) |
| paaA |
|
|
|
|
|
|
Gene: ebA3547: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Daro_0377: Phenylacetate-CoA oxygenase, PaaA subunit |
Gene: Tmz1t_1506: Phenylacetate-CoA oxygenase, PaaA subunit |
|
|
|
Phenylacetate-CoA oxygenase, PaaA subunit |
| paaB |
|
|
|
|
|
|
Gene: ebA3548: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Daro_0378: Phenylacetate-CoA oxygenase, PaaB subunit |
Gene: Tmz1t_1505: Phenylacetate-CoA oxygenase, PaaB subunit |
|
|
|
Phenylacetate-CoA oxygenase, PaaB subunit |
| paaC |
|
|
|
|
|
|
Gene: ebA3550: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Daro_0379: Phenylacetate-CoA oxygenase, PaaC subunit |
Gene: Tmz1t_1504: Phenylacetate-CoA oxygenase, PaaC subunit |
|
|
|
Phenylacetate-CoA oxygenase, PaaC subunit |
| paaD |
|
|
|
|
|
|
Gene: ebA3551: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Daro_0380: Phenylacetate-CoA oxygenase, PaaD subunit |
Gene: Tmz1t_1503: Phenylacetate-CoA oxygenase, PaaD subunit |
|
|
|
Phenylacetate-CoA oxygenase, PaaD subunit |
| paaE |
|
|
|
|
|
|
Gene: ebA3553: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Daro_0381: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
Gene: Tmz1t_1502: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
|
|
|
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) |
| paaR |
|
|
|
|
|
|
Gene: ebA3555: Transcriptional regulator of phenylacetic acid degradation, TetR family |
|
*
Thauera sp. MZ1T Site: position = -241 score = 5.45012 sequence = ATTGATCGACTGGTTGGTCGGA Gene: Tmz1t_2997: Transcriptional regulator of phenylacetic acid degradation, TetR family |
|
|
|
Transcriptional regulator of phenylacetic acid degradation, TetR family |
| paaZ |
|
|
|
|
|
|
*
Azoarcus sp. EbN1 Site: position = -150 score = 5.49437 sequence = TTTGACCGACCGGTCAATCAAT Gene: ebA3541: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Gene: Daro_0370: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
Gene: Tmz1t_1513: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
|
|
|
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ |
| paaY2 |
|
|
|
|
|
|
Gene: ebA3540: Phenylacetic acid degradation protein PaaY |
|
*
Thauera sp. MZ1T Site: position = -236 score = 5.20824 sequence = TCCGACCAACCAGTCGATCAAT Gene: Tmz1t_2998: Phenylacetic acid degradation protein PaaY |
|
|
|
Phenylacetic acid degradation protein PaaY |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |