Regulon of PaaR in Azoarcus sp. EbN1

Properties
Regulator type:	Transcription factor
TF locus tag:	ebA3555
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	12
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -115 Score: 5.6 Sequence: ATTGATTGACCGGTCGGTCAAA Locus tag: ebA3542 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: ebA3543 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: ebA3544 Name: paaI Funciton: Phenylacetic acid degradation protein paaI Locus tag: ebA3545 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: ebA3547 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: ebA3548 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: ebA3550 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: ebA3551 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: ebA3553 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: ebA3555 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	ebA3542	paaG	Enoyl-CoA hydratase (EC 4.2.1.17)
	ebA3543	paaH	3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
	ebA3544	paaI	Phenylacetic acid degradation protein paaI
	ebA3545	paaK	Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
	ebA3547	paaA	Phenylacetate-CoA oxygenase, PaaA subunit
	ebA3548	paaB	Phenylacetate-CoA oxygenase, PaaB subunit
	ebA3550	paaC	Phenylacetate-CoA oxygenase, PaaC subunit
	ebA3551	paaD	Phenylacetate-CoA oxygenase, PaaD subunit
	ebA3553	paaE	Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
	ebA3555	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -150 Score: 5.5 Sequence: TTTGACCGACCGGTCAATCAAT Locus tag: ebA3541 Name: paaZ Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ Locus tag: ebA3540 Name: paaY2 Funciton: Phenylacetic acid degradation protein PaaY
	ebA3541	paaZ	Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
	ebA3540	paaY2	Phenylacetic acid degradation protein PaaY

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD