Regulon of PaaR in Thauera sp. MZ1T

Properties
Regulator type:	Transcription factor
TF locus tag:	Tmz1t_2997
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Regulog:	PaaR - Various betaproteobacteria
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Various betaproteobacteria
By TF family - TetR
By effector - Phenylacetyl-CoA
By pathway - Phenylacetic acid degradation

Regulated operons
	Locus Tag	Name	Function
Position: -241 Score: 5.5 Sequence: ATTGATCGACTGGTTGGTCGGA Locus tag: Tmz1t_2997 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
	Tmz1t_2997	paaR	Transcriptional regulator of phenylacetic acid degradation, TetR family
Position: -236 Score: 5.2 Sequence: TCCGACCAACCAGTCGATCAAT Locus tag: Tmz1t_2998 Name: paaY2 Funciton: Phenylacetic acid degradation protein PaaY
	Tmz1t_2998	paaY2	Phenylacetic acid degradation protein PaaY

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD