Orthologous regulated operons containing paaK gene

Properties
Regulog:	PaaR - Various betaproteobacteria
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Phenylacetic acid degradation
Effector:	Phenylacetyl-CoA
Phylum:	Proteobacteria/Beta

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Azoarcus sp. EbN1
Position: -115 Score: 5.5897 Sequence: ATTGATTGACCGGTCGGTCAAA Locus tag: ebA3542 Name: paaG Funciton: Enoyl-CoA hydratase (EC 4.2.1.17) Locus tag: ebA3543 Name: paaH Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157) Locus tag: ebA3544 Name: paaI Funciton: Phenylacetic acid degradation protein paaI Locus tag: ebA3545 Name: paaK Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30) Locus tag: ebA3547 Name: paaA Funciton: Phenylacetate-CoA oxygenase, PaaA subunit Locus tag: ebA3548 Name: paaB Funciton: Phenylacetate-CoA oxygenase, PaaB subunit Locus tag: ebA3550 Name: paaC Funciton: Phenylacetate-CoA oxygenase, PaaC subunit Locus tag: ebA3551 Name: paaD Funciton: Phenylacetate-CoA oxygenase, PaaD subunit Locus tag: ebA3553 Name: paaE Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-) Locus tag: ebA3555 Name: paaR Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaG-paaH-paaI-paaK-paaA-paaB-paaC-paaD-paaE-paaR	-115	5.6	ATTGATTGACCGGTCGGTCAAA	ebA3542

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --