Regulog CblR - Thermoproteales
| Regulator type: | Transcription factor |
| Regulator family: | |
| Regulation mode: | |
| Biological process: | Cobalamin biosynthesis |
| Effector: | |
| Phylum: | Crenarchaeota |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermoproteales
- By trascription factor - CblR
- By pathway - Cobalamin biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Pyrobaculum arsenaticum DSM 13514 | ||
| Pyrobaculum aerophilum str. IM2 | 12 | 3 |
| Pyrobaculum islandicum DSM 4184 | 3 | 1 |
| Pyrobaculum calidifontis JCM 11548 | 12 | 3 |
| Thermoproteus neutrophilus V24Sta | 7 | 2 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| btuF |
Gene: Pars_2136: Vitamin B12 ABC transporter, B12-binding component BtuF |
*
Pyrobaculum aerophilum str. IM2 Site: position = -21 score = 4.54506 sequence = TAATGGAGGATTCTCCAGCT Gene: PAE0367: Vitamin B12 ABC transporter, B12-binding component BtuF |
Gene: Pisl_1954: Vitamin B12 ABC transporter, B12-binding component BtuF |
*
Pyrobaculum calidifontis JCM 11548 Site: position = -21 score = 5.92645 sequence = TATGGGATATTTCTCCCACA Gene: Pcal_1519: Vitamin B12 ABC transporter, B12-binding component BtuF |
Gene: Tneu_1093: Vitamin B12 ABC transporter, B12-binding component BtuF |
Vitamin B12 ABC transporter, B12-binding component BtuF |
| btuC |
Gene: Pars_2137: Vitamin B12 ABC transporter, permease component BtuC |
Gene: PAE0366: Vitamin B12 ABC transporter, permease component BtuC |
Gene: Pisl_1955: Vitamin B12 ABC transporter, permease component BtuC |
Gene: Pcal_1518: Vitamin B12 ABC transporter, permease component BtuC |
Gene: Tneu_1092: Vitamin B12 ABC transporter, permease component BtuC |
Vitamin B12 ABC transporter, permease component BtuC |
| btuD |
Gene: Pars_2138: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: PAE0360: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: Pisl_1956: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: Pcal_1517: Vitamin B12 ABC transporter, ATPase component BtuD |
Gene: Tneu_1091: Vitamin B12 ABC transporter, ATPase component BtuD |
Vitamin B12 ABC transporter, ATPase component BtuD |
| CRON 2. | ||||||
| nrdD |
|
|
*
Pyrobaculum islandicum DSM 4184 Site: position = -23 score = 6.00215 sequence = TATGGGAAATTTGTCCCTTA Gene: Pisl_0226: Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2) |
|
*
Thermoproteus neutrophilus V24Sta Site: position = -23 score = 5.82613 sequence = TATGGGAAATTTGTCCCCTA Gene: Tneu_0378: Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2) |
Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2) |
| nrdG |
|
|
Gene: Pisl_0225: Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4) |
|
Gene: Tneu_0379: Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4) |
Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4) |
| Pisl_0224 |
|
|
Gene: Pisl_0224: hypothetical protein |
|
Gene: Tneu_0380: hypothetical protein |
hypothetical protein |
| CRON 3. | ||||||
| PAE0341 |
|
*
Pyrobaculum aerophilum str. IM2 Site: position = -23 score = 4.98975 sequence = TATAGGATTTTTTTCCACTA Gene: PAE0341: hypothetical protein |
|
|
|
hypothetical protein |
| cbtA |
|
Gene: PAE0342: Predicted cobalt transporter CbtA |
|
*
Pyrobaculum calidifontis JCM 11548 Site: position = -239 score = 5.10359 sequence = TATAGGAGAAATATCCCAAC Gene: Pcal_1527: Predicted cobalt transporter CbtA |
*
Thermoproteus neutrophilus V24Sta Site: position = -232 score = 5.06005 sequence = TTAGGGATTTTTCTCCATCA Gene: Tneu_0292: Predicted cobalt transporter CbtA |
Predicted cobalt transporter CbtA |
| cbiC |
|
Gene: PAE0343: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
|
Gene: Pcal_1526: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Gene: Tneu_0296: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) |
| cbiH |
Gene: Pars_1221: Cobalt-precorrin-3b C17-methyltransferase |
Gene: PAE0344: Cobalt-precorrin-3b C17-methyltransferase |
|
Gene: Pcal_1525: Cobalt-precorrin-3b C17-methyltransferase |
Gene: Tneu_0297: Cobalt-precorrin-3b C17-methyltransferase |
Cobalt-precorrin-3b C17-methyltransferase |
| cbiD |
|
Gene: PAE0346: Cobalt-precorrin-6 synthase, anaerobic |
|
Gene: Pcal_1524: Cobalt-precorrin-6 synthase, anaerobic |
Gene: Tneu_0298: Cobalt-precorrin-6 synthase, anaerobic |
Cobalt-precorrin-6 synthase, anaerobic |
| cbiT |
|
Gene: PAE0347: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
|
Gene: Pcal_1523: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
Gene: Tneu_0299: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) |
| cbiL |
|
Gene: PAE0348: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
|
Gene: Pcal_1522: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Gene: Tneu_0300: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) |
| cbiF |
|
Gene: PAE0349: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
|
Gene: Pcal_1521: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Gene: Tneu_0301: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133) |
| cbiG |
|
Gene: PAE0339: Cobalamin biosynthesis protein CbiG |
|
Gene: Pcal_1529: Cobalamin biosynthesis protein CbiG |
Gene: Tneu_0291: Cobalamin biosynthesis protein CbiG |
Cobalamin biosynthesis protein CbiG |
| cobD |
|
Gene: PAE0377: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: Pisl_1369: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: Pcal_1536: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
Gene: Tneu_0290: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81) |
| cobS |
|
Gene: PAE0379: Cobalamin-5-phosphate synthase CobS |
Gene: Pisl_1370: Cobalamin-5-phosphate synthase CobS |
Gene: Pcal_1535: Cobalamin-5-phosphate synthase CobS |
Gene: Tneu_0289: Cobalamin-5-phosphate synthase CobS |
Cobalamin-5-phosphate synthase CobS |
| cbiE |
|
*
Pyrobaculum aerophilum str. IM2 Site: position = -89 score = 4.98975 sequence = TAGTGGAAAAAAATCCTATA Gene: PAE0340: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
|
*
Pyrobaculum calidifontis JCM 11548 Site: position = -65 score = 5.10359 sequence = GTTGGGATATTTCTCCTATA Gene: Pcal_1528: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
|
Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |