Regulog CblR - Thermoproteales

Properties
Regulator type:	Transcription factor
Regulator family:
Regulation mode:
Biological process:	Cobalamin biosynthesis
Effector:
Phylum:	Crenarchaeota
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermoproteales
By trascription factor - CblR
By pathway - Cobalamin biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Pyrobaculum arsenaticum DSM 13514
Pyrobaculum aerophilum str. IM2	12	3
Pyrobaculum islandicum DSM 4184	3	1
Pyrobaculum calidifontis JCM 11548	12	3
Thermoproteus neutrophilus V24Sta	7	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes						Function

CRON 1.
btuF	Pyrobaculum arsenaticum DSM 13514 Gene: Pars_2136: Vitamin B12 ABC transporter, B12-binding component BtuF	* Pyrobaculum aerophilum str. IM2 Site: position = -21 score = 4.54506 sequence = TAATGGAGGATTCTCCAGCT Gene: PAE0367: Vitamin B12 ABC transporter, B12-binding component BtuF	Pyrobaculum islandicum DSM 4184 Gene: Pisl_1954: Vitamin B12 ABC transporter, B12-binding component BtuF	* Pyrobaculum calidifontis JCM 11548 Site: position = -21 score = 5.92645 sequence = TATGGGATATTTCTCCCACA Gene: Pcal_1519: Vitamin B12 ABC transporter, B12-binding component BtuF	Thermoproteus neutrophilus V24Sta Gene: Tneu_1093: Vitamin B12 ABC transporter, B12-binding component BtuF	Vitamin B12 ABC transporter, B12-binding component BtuF
btuC	Pyrobaculum arsenaticum DSM 13514 Gene: Pars_2137: Vitamin B12 ABC transporter, permease component BtuC	Pyrobaculum aerophilum str. IM2 Gene: PAE0366: Vitamin B12 ABC transporter, permease component BtuC	Pyrobaculum islandicum DSM 4184 Gene: Pisl_1955: Vitamin B12 ABC transporter, permease component BtuC	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1518: Vitamin B12 ABC transporter, permease component BtuC	Thermoproteus neutrophilus V24Sta Gene: Tneu_1092: Vitamin B12 ABC transporter, permease component BtuC	Vitamin B12 ABC transporter, permease component BtuC
btuD	Pyrobaculum arsenaticum DSM 13514 Gene: Pars_2138: Vitamin B12 ABC transporter, ATPase component BtuD	Pyrobaculum aerophilum str. IM2 Gene: PAE0360: Vitamin B12 ABC transporter, ATPase component BtuD	Pyrobaculum islandicum DSM 4184 Gene: Pisl_1956: Vitamin B12 ABC transporter, ATPase component BtuD	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1517: Vitamin B12 ABC transporter, ATPase component BtuD	Thermoproteus neutrophilus V24Sta Gene: Tneu_1091: Vitamin B12 ABC transporter, ATPase component BtuD	Vitamin B12 ABC transporter, ATPase component BtuD

CRON 2.
nrdD	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2	* Pyrobaculum islandicum DSM 4184 Site: position = -23 score = 6.00215 sequence = TATGGGAAATTTGTCCCTTA Gene: Pisl_0226: Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2)	Pyrobaculum calidifontis JCM 11548	* Thermoproteus neutrophilus V24Sta Site: position = -23 score = 5.82613 sequence = TATGGGAAATTTGTCCCCTA Gene: Tneu_0378: Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2)	Ribonucleotide reductase of class III (anaerobic), large subunit (EC 1.17.4.2)
nrdG	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2	Pyrobaculum islandicum DSM 4184 Gene: Pisl_0225: Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4)	Pyrobaculum calidifontis JCM 11548	Thermoproteus neutrophilus V24Sta Gene: Tneu_0379: Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4)	Ribonucleotide reductase of class III (anaerobic), activating protein (EC 1.97.1.4)
Pisl_0224	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2	Pyrobaculum islandicum DSM 4184 Gene: Pisl_0224: hypothetical protein	Pyrobaculum calidifontis JCM 11548	Thermoproteus neutrophilus V24Sta Gene: Tneu_0380: hypothetical protein	hypothetical protein

CRON 3.
PAE0341	Pyrobaculum arsenaticum DSM 13514	* Pyrobaculum aerophilum str. IM2 Site: position = -23 score = 4.98975 sequence = TATAGGATTTTTTTCCACTA Gene: PAE0341: hypothetical protein	Pyrobaculum islandicum DSM 4184	Pyrobaculum calidifontis JCM 11548	Thermoproteus neutrophilus V24Sta	hypothetical protein
cbtA	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0342: Predicted cobalt transporter CbtA	Pyrobaculum islandicum DSM 4184	* Pyrobaculum calidifontis JCM 11548 Site: position = -239 score = 5.10359 sequence = TATAGGAGAAATATCCCAAC Gene: Pcal_1527: Predicted cobalt transporter CbtA	* Thermoproteus neutrophilus V24Sta Site: position = -232 score = 5.06005 sequence = TTAGGGATTTTTCTCCATCA Gene: Tneu_0292: Predicted cobalt transporter CbtA	Predicted cobalt transporter CbtA
cbiC	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0343: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)	Pyrobaculum islandicum DSM 4184	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1526: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)	Thermoproteus neutrophilus V24Sta Gene: Tneu_0296: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)	Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
cbiH	Pyrobaculum arsenaticum DSM 13514 Gene: Pars_1221: Cobalt-precorrin-3b C17-methyltransferase	Pyrobaculum aerophilum str. IM2 Gene: PAE0344: Cobalt-precorrin-3b C17-methyltransferase	Pyrobaculum islandicum DSM 4184	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1525: Cobalt-precorrin-3b C17-methyltransferase	Thermoproteus neutrophilus V24Sta Gene: Tneu_0297: Cobalt-precorrin-3b C17-methyltransferase	Cobalt-precorrin-3b C17-methyltransferase
cbiD	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0346: Cobalt-precorrin-6 synthase, anaerobic	Pyrobaculum islandicum DSM 4184	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1524: Cobalt-precorrin-6 synthase, anaerobic	Thermoproteus neutrophilus V24Sta Gene: Tneu_0298: Cobalt-precorrin-6 synthase, anaerobic	Cobalt-precorrin-6 synthase, anaerobic
cbiT	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0347: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)	Pyrobaculum islandicum DSM 4184	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1523: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)	Thermoproteus neutrophilus V24Sta Gene: Tneu_0299: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)	Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
cbiL	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0348: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)	Pyrobaculum islandicum DSM 4184	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1522: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)	Thermoproteus neutrophilus V24Sta Gene: Tneu_0300: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)	Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
cbiF	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0349: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)	Pyrobaculum islandicum DSM 4184	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1521: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)	Thermoproteus neutrophilus V24Sta Gene: Tneu_0301: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)	Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
cbiG	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0339: Cobalamin biosynthesis protein CbiG	Pyrobaculum islandicum DSM 4184	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1529: Cobalamin biosynthesis protein CbiG	Thermoproteus neutrophilus V24Sta Gene: Tneu_0291: Cobalamin biosynthesis protein CbiG	Cobalamin biosynthesis protein CbiG
cobD	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0377: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)	Pyrobaculum islandicum DSM 4184 Gene: Pisl_1369: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1536: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)	Thermoproteus neutrophilus V24Sta Gene: Tneu_0290: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)	L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
cobS	Pyrobaculum arsenaticum DSM 13514	Pyrobaculum aerophilum str. IM2 Gene: PAE0379: Cobalamin-5-phosphate synthase CobS	Pyrobaculum islandicum DSM 4184 Gene: Pisl_1370: Cobalamin-5-phosphate synthase CobS	Pyrobaculum calidifontis JCM 11548 Gene: Pcal_1535: Cobalamin-5-phosphate synthase CobS	Thermoproteus neutrophilus V24Sta Gene: Tneu_0289: Cobalamin-5-phosphate synthase CobS	Cobalamin-5-phosphate synthase CobS
cbiE	Pyrobaculum arsenaticum DSM 13514	* Pyrobaculum aerophilum str. IM2 Site: position = -89 score = 4.98975 sequence = TAGTGGAAAAAAATCCTATA Gene: PAE0340: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)	Pyrobaculum islandicum DSM 4184	* Pyrobaculum calidifontis JCM 11548 Site: position = -65 score = 5.10359 sequence = GTTGGGATATTTCTCCTATA Gene: Pcal_1528: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)	Thermoproteus neutrophilus V24Sta	Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog CblR - Thermoproteales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --