Regulon of CblR in Pyrobaculum aerophilum str. IM2

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:
Regulation mode:
Biological process:	Cobalamin biosynthesis
Effector:
Regulog:	CblR - Thermoproteales
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermoproteales
By trascription factor - CblR
By pathway - Cobalamin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -21 Score: 4.5 Sequence: TAATGGAGGATTCTCCAGCT Locus tag: PAE0367 Name: btuF Funciton: Vitamin B12 ABC transporter, B12-binding component BtuF Locus tag: PAE0366 Name: btuC Funciton: Vitamin B12 ABC transporter, permease component BtuC
	PAE0367	btuF	Vitamin B12 ABC transporter, B12-binding component BtuF
	PAE0366	btuC	Vitamin B12 ABC transporter, permease component BtuC
Position: -89 Score: 5 Sequence: TAGTGGAAAAAAATCCTATA Locus tag: PAE0340 Name: cbiE Funciton: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) Locus tag: PAE0339 Name: cbiG Funciton: Cobalamin biosynthesis protein CbiG
	PAE0340	cbiE	Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
	PAE0339	cbiG	Cobalamin biosynthesis protein CbiG
Position: -23 Score: 5 Sequence: TATAGGATTTTTTTCCACTA Locus tag: PAE0341 Name: null Funciton: hypothetical protein Locus tag: PAE0342 Name: cbtA Funciton: Predicted cobalt transporter CbtA Locus tag: PAE0343 Name: cbiC Funciton: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) Locus tag: PAE0344 Name: cbiH Funciton: Cobalt-precorrin-3b C17-methyltransferase Locus tag: PAE0346 Name: cbiD Funciton: Cobalt-precorrin-6 synthase, anaerobic Locus tag: PAE0347 Name: cbiT Funciton: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) Locus tag: PAE0348 Name: cbiL Funciton: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) Locus tag: PAE0349 Name: cbiF Funciton: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
	PAE0341		hypothetical protein
	PAE0342	cbtA	Predicted cobalt transporter CbtA
	PAE0343	cbiC	Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
	PAE0344	cbiH	Cobalt-precorrin-3b C17-methyltransferase
	PAE0346	cbiD	Cobalt-precorrin-6 synthase, anaerobic
	PAE0347	cbiT	Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
	PAE0348	cbiL	Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
	PAE0349	cbiF	Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD