Regulon of CblR in Pyrobaculum calidifontis JCM 11548

Properties
Regulator type:	Transcription factor
TF locus tag:
Regulator family:
Regulation mode:
Biological process:	Cobalamin biosynthesis
Effector:
Regulog:	CblR - Thermoproteales
Statistics of regulated genes:
- Genes	12
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Thermoproteales
By trascription factor - CblR
By pathway - Cobalamin biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 5.1 Sequence: GTTGGGATATTTCTCCTATA Locus tag: Pcal_1528 Name: cbiE Funciton: Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-) Locus tag: Pcal_1529 Name: cbiG Funciton: Cobalamin biosynthesis protein CbiG
	Pcal_1528	cbiE	Cobalt-precorrin-6y C5-methyltransferase (EC 2.1.1.-)
	Pcal_1529	cbiG	Cobalamin biosynthesis protein CbiG
Position: -239 Score: 5.1 Sequence: TATAGGAGAAATATCCCAAC Locus tag: Pcal_1527 Name: cbtA Funciton: Predicted cobalt transporter CbtA Locus tag: Pcal_1526 Name: cbiC Funciton: Cobalt-precorrin-8x methylmutase (EC 5.4.1.2) Locus tag: Pcal_1525 Name: cbiH Funciton: Cobalt-precorrin-3b C17-methyltransferase Locus tag: Pcal_1524 Name: cbiD Funciton: Cobalt-precorrin-6 synthase, anaerobic Locus tag: Pcal_1523 Name: cbiT Funciton: Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-) Locus tag: Pcal_1522 Name: cbiL Funciton: Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130) Locus tag: Pcal_1521 Name: cbiF Funciton: Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
	Pcal_1527	cbtA	Predicted cobalt transporter CbtA
	Pcal_1526	cbiC	Cobalt-precorrin-8x methylmutase (EC 5.4.1.2)
	Pcal_1525	cbiH	Cobalt-precorrin-3b C17-methyltransferase
	Pcal_1524	cbiD	Cobalt-precorrin-6 synthase, anaerobic
	Pcal_1523	cbiT	Cobalt-precorrin-6y C15-methyltransferase [decarboxylating] (EC 2.1.1.-)
	Pcal_1522	cbiL	Cobalt-precorrin-2 C20-methyltransferase (EC 2.1.1.130)
	Pcal_1521	cbiF	Cobalt-precorrin-4 C11-methyltransferase (EC 2.1.1.133)
Position: -21 Score: 5.9 Sequence: TATGGGATATTTCTCCCACA Locus tag: Pcal_1519 Name: btuF Funciton: Vitamin B12 ABC transporter, B12-binding component BtuF Locus tag: Pcal_1518 Name: btuC Funciton: Vitamin B12 ABC transporter, permease component BtuC Locus tag: Pcal_1517 Name: btuD Funciton: Vitamin B12 ABC transporter, ATPase component BtuD
	Pcal_1519	btuF	Vitamin B12 ABC transporter, B12-binding component BtuF
	Pcal_1518	btuC	Vitamin B12 ABC transporter, permease component BtuC
	Pcal_1517	btuD	Vitamin B12 ABC transporter, ATPase component BtuD

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD