Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing cobS gene

Properties
Regulog: CblR - Thermoproteales
Regulator type: Transcription factor
Regulator family:
Regulation mode:
Biological process: Cobalamin biosynthesis
Effector:
Phylum: Crenarchaeota
Built upon 9 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Thermoproteus neutrophilus V24Sta
Position: -232
Score: 5.06005
Sequence: TTAGGGATTTTTCTCCATCA
Locus tag: Tneu_0292
Name: cbtA
Funciton: Predicted cobalt transporter CbtA
Locus tag: Tneu_0291
Name: cbiG
Funciton: Cobalamin biosynthesis protein CbiG
Locus tag: Tneu_0290
Name: cobD
Funciton: L-threonine 3-O-phosphate decarboxylase (EC 4.1.1.81)
Locus tag: Tneu_0289
Name: cobS
Funciton: Cobalamin-5-phosphate synthase CobS
cbtA-cbiG-cobD-cobS -232 5.1 TTAGGGATTTTTCTCCATCA Tneu_0292