Regulog MntR - Staphylococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Statistics of regulated genes
Genome	Genes	Operons
Staphylococcus aureus subsp. aureus N315	4	2
Staphylococcus capitis SK14	4	2
Staphylococcus epidermidis ATCC 12228	4	2
Staphylococcus carnosus subsp. carnosus TM300	4	2
Staphylococcus haemolyticus JCSC1435	4	2
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305	4	2
Macrococcus caseolyticus JCSC5402	4	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
mntH	* Staphylococcus aureus subsp. aureus N315 Site: position = -67 score = 6.28253 sequence = AATTTAGGTTGACCTAAACA Gene: SA0956: Mn2+/Fe2+ transporter, NRAMP family	* Staphylococcus capitis SK14 Site: position = -66 score = 6.08709 sequence = TTTTTAGGTTGACCTAACTT Gene: STACA0001_2258: Mn2+/Fe2+ transporter, NRAMP family	* Staphylococcus epidermidis ATCC 12228 Site: position = -51 score = 6.33114 sequence = TTTTTAGGTTGACCTAATAT Site: position = -29 score = 4.61618 sequence = TATTTAGGTTAATATATTCT Gene: SE0803: Mn2+/Fe2+ transporter, NRAMP family	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -76 score = 6.08709 sequence = TTTTTAGGTTGACCTAACTT Gene: Sca_0731: Mn2+/Fe2+ transporter, NRAMP family	* Staphylococcus haemolyticus JCSC1435 Site: position = -65 score = 6.30942 sequence = TTATTAGGTTGACCTAAAAA Gene: SH1847: Mn2+/Fe2+ transporter, NRAMP family	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -73 score = 6.30942 sequence = TTTTTAGGTTGACCTAATAA Gene: SSP1685: Mn2+/Fe2+ transporter, NRAMP family	* Macrococcus caseolyticus JCSC5402 Site: position = -52 score = 5.68233 sequence = TTTTTAGGTTGCCCTAAAGA Gene: MCCL_0368: Mn2+/Fe2+ transporter, NRAMP family	Mn2+/Fe2+ transporter, NRAMP family

CRON 2.
mntA	* Staphylococcus aureus subsp. aureus N315 Site: position = -42 score = 6.12446 sequence = TAATTAGGTTAGCCTAAACT Gene: SA0589: manganese ABC transport system ATPase component MntA	* Staphylococcus capitis SK14 Site: position = -42 score = 6.14618 sequence = AAATTAGGTTAGCCTAAACT Gene: STACA0001_0395: manganese ABC transport system ATPase component MntA	* Staphylococcus epidermidis ATCC 12228 Site: position = -42 score = 6.36587 sequence = AAATTAGGTTAACCTAAACT Gene: SE0407: manganese ABC transport system ATPase component MntA	* Staphylococcus carnosus subsp. carnosus TM300 Site: position = -141 score = 6.22598 sequence = AAATTAGGTTAGCCTAAAAA Gene: Sca_0275: manganese ABC transport system ATPase component MntA	* Staphylococcus haemolyticus JCSC1435 Site: position = -40 score = 6.36587 sequence = AAATTAGGTTAACCTAAACT Gene: SH0143: manganese ABC transport system ATPase component MntA	* Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -40 score = 6.22598 sequence = AAATTAGGTTAGCCTAAAAA Gene: SSP2086: manganese ABC transport system ATPase component MntA	* Macrococcus caseolyticus JCSC5402 Site: position = -52 score = 5.8918 sequence = AGTTTAGGTTTGCCTAAAAT Gene: MCCL_0095: manganese ABC transport system ATPase component MntA	manganese ABC transport system ATPase component MntA
mntB	Staphylococcus aureus subsp. aureus N315 Gene: SA0588: manganese ABC transport system membrane protein MntB	Staphylococcus capitis SK14 Gene: STACA0001_0396: manganese ABC transport system membrane protein MntB	Staphylococcus epidermidis ATCC 12228 Gene: SE0406: manganese ABC transport system membrane protein MntB	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0274: manganese ABC transport system membrane protein MntB	Staphylococcus haemolyticus JCSC1435 Gene: SH0142: manganese ABC transport system membrane protein MntB	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2087: manganese ABC transport system membrane protein MntB	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0094: manganese ABC transport system membrane protein MntB	manganese ABC transport system membrane protein MntB
mntC	Staphylococcus aureus subsp. aureus N315 Gene: SA0587: manganese ABC transport system substrate-binding protein MntC	Staphylococcus capitis SK14 Gene: STACA0001_0397: manganese ABC transport system substrate-binding protein MntC	Staphylococcus epidermidis ATCC 12228 Gene: SE0405: manganese ABC transport system substrate-binding protein MntC	Staphylococcus carnosus subsp. carnosus TM300 Gene: Sca_0273: manganese ABC transport system substrate-binding protein MntC	Staphylococcus haemolyticus JCSC1435 Gene: SH0141: manganese ABC transport system substrate-binding protein MntC	Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Gene: SSP2088: manganese ABC transport system substrate-binding protein MntC	Macrococcus caseolyticus JCSC5402 Gene: MCCL_0093: manganese ABC transport system substrate-binding protein MntC	manganese ABC transport system substrate-binding protein MntC

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MntR - Staphylococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --