Regulog MntR - Staphylococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Staphylococcaceae
- By trascription factor - MntR
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Staphylococcus aureus subsp. aureus N315 | 4 | 2 |
| Staphylococcus capitis SK14 | 4 | 2 |
| Staphylococcus epidermidis ATCC 12228 | 4 | 2 |
| Staphylococcus carnosus subsp. carnosus TM300 | 4 | 2 |
| Staphylococcus haemolyticus JCSC1435 | 4 | 2 |
| Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 | 4 | 2 |
| Macrococcus caseolyticus JCSC5402 | 4 | 2 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| mntH |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -67 score = 6.28253 sequence = AATTTAGGTTGACCTAAACA Gene: SA0956: Mn2+/Fe2+ transporter, NRAMP family |
*
Staphylococcus capitis SK14 Site: position = -66 score = 6.08709 sequence = TTTTTAGGTTGACCTAACTT Gene: STACA0001_2258: Mn2+/Fe2+ transporter, NRAMP family |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -51 score = 6.33114 sequence = TTTTTAGGTTGACCTAATAT Site: position = -29 score = 4.61618 sequence = TATTTAGGTTAATATATTCT Gene: SE0803: Mn2+/Fe2+ transporter, NRAMP family |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -76 score = 6.08709 sequence = TTTTTAGGTTGACCTAACTT Gene: Sca_0731: Mn2+/Fe2+ transporter, NRAMP family |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -65 score = 6.30942 sequence = TTATTAGGTTGACCTAAAAA Gene: SH1847: Mn2+/Fe2+ transporter, NRAMP family |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -73 score = 6.30942 sequence = TTTTTAGGTTGACCTAATAA Gene: SSP1685: Mn2+/Fe2+ transporter, NRAMP family |
*
Macrococcus caseolyticus JCSC5402 Site: position = -52 score = 5.68233 sequence = TTTTTAGGTTGCCCTAAAGA Gene: MCCL_0368: Mn2+/Fe2+ transporter, NRAMP family |
Mn2+/Fe2+ transporter, NRAMP family |
| CRON 2. | ||||||||
| mntA |
*
Staphylococcus aureus subsp. aureus N315 Site: position = -42 score = 6.12446 sequence = TAATTAGGTTAGCCTAAACT Gene: SA0589: manganese ABC transport system ATPase component MntA |
*
Staphylococcus capitis SK14 Site: position = -42 score = 6.14618 sequence = AAATTAGGTTAGCCTAAACT Gene: STACA0001_0395: manganese ABC transport system ATPase component MntA |
*
Staphylococcus epidermidis ATCC 12228 Site: position = -42 score = 6.36587 sequence = AAATTAGGTTAACCTAAACT Gene: SE0407: manganese ABC transport system ATPase component MntA |
*
Staphylococcus carnosus subsp. carnosus TM300 Site: position = -141 score = 6.22598 sequence = AAATTAGGTTAGCCTAAAAA Gene: Sca_0275: manganese ABC transport system ATPase component MntA |
*
Staphylococcus haemolyticus JCSC1435 Site: position = -40 score = 6.36587 sequence = AAATTAGGTTAACCTAAACT Gene: SH0143: manganese ABC transport system ATPase component MntA |
*
Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305 Site: position = -40 score = 6.22598 sequence = AAATTAGGTTAGCCTAAAAA Gene: SSP2086: manganese ABC transport system ATPase component MntA |
*
Macrococcus caseolyticus JCSC5402 Site: position = -52 score = 5.8918 sequence = AGTTTAGGTTTGCCTAAAAT Gene: MCCL_0095: manganese ABC transport system ATPase component MntA |
manganese ABC transport system ATPase component MntA |
| mntB |
Gene: SA0588: manganese ABC transport system membrane protein MntB |
Gene: STACA0001_0396: manganese ABC transport system membrane protein MntB |
Gene: SE0406: manganese ABC transport system membrane protein MntB |
Gene: Sca_0274: manganese ABC transport system membrane protein MntB |
Gene: SH0142: manganese ABC transport system membrane protein MntB |
Gene: SSP2087: manganese ABC transport system membrane protein MntB |
Gene: MCCL_0094: manganese ABC transport system membrane protein MntB |
manganese ABC transport system membrane protein MntB |
| mntC |
Gene: SA0587: manganese ABC transport system substrate-binding protein MntC |
Gene: STACA0001_0397: manganese ABC transport system substrate-binding protein MntC |
Gene: SE0405: manganese ABC transport system substrate-binding protein MntC |
Gene: Sca_0273: manganese ABC transport system substrate-binding protein MntC |
Gene: SH0141: manganese ABC transport system substrate-binding protein MntC |
Gene: SSP2088: manganese ABC transport system substrate-binding protein MntC |
Gene: MCCL_0093: manganese ABC transport system substrate-binding protein MntC |
manganese ABC transport system substrate-binding protein MntC |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |