Regulon of MntR in Staphylococcus capitis SK14

Properties
Regulator type:	Transcription factor
TF locus tag:	STACA0001_0394
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Staphylococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.1 Sequence: TTTTTAGGTTGACCTAACTT Locus tag: STACA0001_2258 Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family
	STACA0001_2258	mntH	Mn2+/Fe2+ transporter, NRAMP family
Position: -42 Score: 6.1 Sequence: AAATTAGGTTAGCCTAAACT Locus tag: STACA0001_0395 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: STACA0001_0396 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: STACA0001_0397 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
	STACA0001_0395	mntA	manganese ABC transport system ATPase component MntA
	STACA0001_0396	mntB	manganese ABC transport system membrane protein MntB
	STACA0001_0397	mntC	manganese ABC transport system substrate-binding protein MntC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD