Regulon of MntR in Macrococcus caseolyticus JCSC5402

Properties
Regulator type:	Transcription factor
TF locus tag:	MCCL_0096
Regulator family:	DtxR
Regulation mode:	repressor
Biological process:	Manganese homeostasis
Effector:	Manganese ion, (Mn2+)
Regulog:	MntR - Staphylococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - MntR
By TF family - DtxR
By effector - Manganese ion, (Mn2+)
By pathway - Manganese homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.7 Sequence: TTTTTAGGTTGCCCTAAAGA Locus tag: MCCL_0368 Name: mntH Funciton: Mn2+/Fe2+ transporter, NRAMP family
	MCCL_0368	mntH	Mn2+/Fe2+ transporter, NRAMP family
Position: -52 Score: 5.9 Sequence: AGTTTAGGTTTGCCTAAAAT Locus tag: MCCL_0095 Name: mntA Funciton: manganese ABC transport system ATPase component MntA Locus tag: MCCL_0094 Name: mntB Funciton: manganese ABC transport system membrane protein MntB Locus tag: MCCL_0093 Name: mntC Funciton: manganese ABC transport system substrate-binding protein MntC
	MCCL_0095	mntA	manganese ABC transport system ATPase component MntA
	MCCL_0094	mntB	manganese ABC transport system membrane protein MntB
	MCCL_0093	mntC	manganese ABC transport system substrate-binding protein MntC

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD