Regulog BDP_2071 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - ROK
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | 5 | 2 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | 5 | 2 |
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| BDP_2071 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -173 score = 5.99967 sequence = TTGCGTTCAGTTGTCAAACTCAA Gene: BDP_2071: Transcriptional regulator, ROK family |
|
*
Bifidobacterium longum NCC2705 Site: position = -161 score = 5.93346 sequence = TTGAGTTAAGTTGTCAAACTCAA Gene: BL1693: Transcriptional regulator, ROK family |
|
Transcriptional regulator, ROK family |
| BDP_2072 |
|
|
|
Gene: BLA_0052: ABC transporter, ATP-binding protein |
|
|
Gene: BDP_2072: ABC transporter, ATP-binding protein |
|
Gene: BL1692: ABC transporter, ATP-binding protein |
|
ABC transporter, ATP-binding protein |
| CRON 2. | |||||||||||
| BDP_2070 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -106 score = 5.99967 sequence = TTGAGTTTGACAACTGAACGCAA Gene: BDP_2070: ABC transporter, sugar-binding component |
|
*
Bifidobacterium longum NCC2705 Site: position = -113 score = 5.93346 sequence = TTGAGTTTGACAACTTAACTCAA Gene: BL1694: ABC transporter, sugar-binding component |
|
ABC transporter, sugar-binding component |
| BDP_2069 |
|
|
|
|
|
|
Gene: BDP_2069: ABC transporter, ATP-binding component |
|
Gene: BL1695: ABC transporter, ATP-binding component |
|
ABC transporter, ATP-binding component |
| BDP_2068 |
|
|
|
|
|
|
Gene: BDP_2068: ABC transporter, permease component |
|
Gene: BL1696: ABC transporter, permease component |
|
ABC transporter, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |