Regulon of BDP_2071 in Bifidobacterium longum NCC2705

Properties
Regulator type:	Transcription factor
TF locus tag:	BL1693
Regulator family:	ROK
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BDP_2071 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -113 Score: 5.9 Sequence: TTGAGTTTGACAACTTAACTCAA Locus tag: BL1694 Name: BDP_2070 Funciton: ABC transporter, sugar-binding component Locus tag: BL1695 Name: BDP_2069 Funciton: ABC transporter, ATP-binding component Locus tag: BL1696 Name: BDP_2068 Funciton: ABC transporter, permease component
	BL1694	BDP_2070	ABC transporter, sugar-binding component
	BL1695	BDP_2069	ABC transporter, ATP-binding component
	BL1696	BDP_2068	ABC transporter, permease component
Position: -161 Score: 5.9 Sequence: TTGAGTTAAGTTGTCAAACTCAA Locus tag: BL1693 Name: null Funciton: Transcriptional regulator, ROK family Locus tag: BL1692 Name: BDP_2072 Funciton: ABC transporter, ATP-binding protein
	BL1693		Transcriptional regulator, ROK family
	BL1692	BDP_2072	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD