Profile of regulator BDP_2071 in Bifidobacteriaceae
| Regulator family: | ROK |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Regulog: | BDP_2071 - Bifidobacteriaceae |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - ROK
- By pathway - Carbohydrate metabolism
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bifidobacterium dentium Bd1 | |||||
| BDP_2070 | BDP_2070 | -106 | 6 | TTGAGTTTGACAACTGAACGCAA | |
| BDP_2071 | null | -173 | 6 | TTGCGTTCAGTTGTCAAACTCAA | |
| Bifidobacterium longum NCC2705 | |||||
| BL1694 | BDP_2070 | -113 | 5.9 | TTGAGTTTGACAACTTAACTCAA | |
| BL1693 | null | -161 | 5.9 | TTGAGTTAAGTTGTCAAACTCAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |