Regulon of BDP_2071 in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_2071
Regulator family:	ROK
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BDP_2071 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - ROK
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 6 Sequence: TTGAGTTTGACAACTGAACGCAA Locus tag: BDP_2070 Name: BDP_2070 Funciton: ABC transporter, sugar-binding component Locus tag: BDP_2069 Name: BDP_2069 Funciton: ABC transporter, ATP-binding component Locus tag: BDP_2068 Name: BDP_2068 Funciton: ABC transporter, permease component
	BDP_2070	BDP_2070	ABC transporter, sugar-binding component
	BDP_2069	BDP_2069	ABC transporter, ATP-binding component
	BDP_2068	BDP_2068	ABC transporter, permease component
Position: -173 Score: 6 Sequence: TTGCGTTCAGTTGTCAAACTCAA Locus tag: BDP_2071 Name: null Funciton: Transcriptional regulator, ROK family Locus tag: BDP_2072 Name: BDP_2072 Funciton: ABC transporter, ATP-binding protein
	BDP_2071		Transcriptional regulator, ROK family
	BDP_2072	BDP_2072	ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD