Regulog NanR - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Sialic acid utilization |
| Effector: | Sialic acid |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - GntR/Others
- By effector - Sialic acid
- By pathway - Sialic acid utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 9 | 3 |
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 8 | 2 |
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | 6 | 2 |
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| nanH |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -200 score = 6.50645 sequence = ATAAGACGTCTGACGTCTTAT Site: position = -102 score = 5.00828 sequence = ATCAGACGTCTGATGTTTCCC Gene: Blon_0646: Sialidase (EC 3.2.1.18) |
|
|
|
|
Gene: BIFBRE_01961: Sialidase (EC 3.2.1.18) |
|
|
|
|
Sialidase (EC 3.2.1.18) |
| CRON 2. | |||||||||||
| SSF51658 |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -73 score = 5.23675 sequence = GATATACATCAGATGTCTGAT Site: position = -66 score = 5.42942 sequence = ATCAGATGTCTGATGTATAAT Gene: Blon_0643: Xylose isomerase-like, TIM barrel domain |
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -36 score = 6.25217 sequence = ATTGGACATCAGACGTCTGAT Gene: BIFBRE_01949: Xylose isomerase-like, TIM barrel domain |
|
*
Bifidobacterium gallicum DSM 20093 Site: position = -220 score = 6.07793 sequence = GTAAGACATCAGATGTCTGAT Gene: BIFGAL_00397: Xylose isomerase-like, TIM barrel domain |
|
|
Xylose isomerase-like, TIM barrel domain |
| nanK |
Gene: Blon_0644: N-acetylmannosamine kinase (EC 2.7.1.60) |
|
|
|
|
Gene: BIFBRE_01950: N-acetylmannosamine kinase (EC 2.7.1.60) |
|
|
|
|
N-acetylmannosamine kinase (EC 2.7.1.60) |
| nanE |
Gene: Blon_0645: N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) |
|
|
|
|
|
|
|
|
|
N-acetylmannosamine-6-phosphate 2-epimerase (EC 5.1.3.9) |
| CRON 3. | |||||||||||
| nanB |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -250 score = 4.89816 sequence = GGGAAACATCAGACGTCTGAT Site: position = -152 score = 6.58557 sequence = ATAAGACGTCAGACGTCTTAT Gene: Blon_0647: Predicted sialic acid ABC transporter, solute binding component |
|
|
|
|
*
Bifidobacterium breve DSM 20213 Site: position = -149 score = 5.51163 sequence = ATAAGTTGTCTGATGTCTTAA Site: position = -42 score = 5.83195 sequence = ATCAGACATCAGATGTCATAT Gene: BIFBRE_01954: Predicted sialic acid ABC transporter, solute binding component |
|
*
Bifidobacterium gallicum DSM 20093 Site: position = -12 score = 6.18943 sequence = ATCAGACATCTGATGTCTTAC Gene: BIFGAL_00396: Predicted sialic acid ABC transporter, solute binding component |
|
|
Predicted sialic acid ABC transporter, solute binding component |
| nanC |
Gene: Blon_0648: Predicted sialic acid ABC transporter, permease component |
|
|
|
|
Gene: BIFBRE_01955: Predicted sialic acid ABC transporter, permease component |
|
Gene: BIFGAL_00395: Predicted sialic acid ABC transporter, permease component |
|
|
Predicted sialic acid ABC transporter, permease component |
| nanD |
Gene: Blon_0649: Predicted sialic acid ABC transporter, permease component and ATP-binding component |
|
|
|
|
Gene: BIFBRE_01956: Predicted sialic acid ABC transporter, permease component and ATP-binding component |
|
Gene: BIFGAL_00394: Predicted sialic acid ABC transporter, permease component and ATP-binding component |
|
|
Predicted sialic acid ABC transporter, permease component and ATP-binding component |
| nanF |
Gene: Blon_0650: Predicted sialic acid ABC transporter, ATP binding component |
|
|
|
|
Gene: BIFBRE_01957: Predicted sialic acid ABC transporter, ATP binding component |
|
Gene: BIFGAL_00393: Predicted sialic acid ABC transporter, ATP binding component |
|
|
Predicted sialic acid ABC transporter, ATP binding component |
| nanA |
Gene: Blon_0651: N-acetylneuraminate lyase (EC 2.5.1.56) |
|
|
|
|
Gene: BIFBRE_01958: N-acetylneuraminate lyase (EC 2.5.1.56) |
|
Gene: BIFGAL_00392: N-acetylneuraminate lyase (EC 2.5.1.56) |
|
|
N-acetylneuraminate lyase (EC 2.5.1.56) |
| nagB2 |
|
|
|
|
|
Gene: BIFBRE_01959: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
|
|
|
|
Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |