Regulon of NanR in Bifidobacterium gallicum DSM 20093

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFGAL_01415
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Sialic acid utilization
Effector:	Sialic acid
Regulog:	NanR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - GntR/Others
By effector - Sialic acid
By pathway - Sialic acid utilization

Regulated operons
	Locus Tag	Name	Function
Position: -220 Score: 6.1 Sequence: GTAAGACATCAGATGTCTGAT Locus tag: BIFGAL_00397 Name: SSF51658 Funciton: Xylose isomerase-like, TIM barrel domain
	BIFGAL_00397	SSF51658	Xylose isomerase-like, TIM barrel domain
Position: -12 Score: 6.2 Sequence: ATCAGACATCTGATGTCTTAC Locus tag: BIFGAL_00396 Name: nanB Funciton: Predicted sialic acid ABC transporter, solute binding component Locus tag: BIFGAL_00395 Name: nanC Funciton: Predicted sialic acid ABC transporter, permease component Locus tag: BIFGAL_00394 Name: nanD Funciton: Predicted sialic acid ABC transporter, permease component and ATP-binding component Locus tag: BIFGAL_00393 Name: nanF Funciton: Predicted sialic acid ABC transporter, ATP binding component Locus tag: BIFGAL_00392 Name: nanA Funciton: N-acetylneuraminate lyase (EC 2.5.1.56)
	BIFGAL_00396	nanB	Predicted sialic acid ABC transporter, solute binding component
	BIFGAL_00395	nanC	Predicted sialic acid ABC transporter, permease component
	BIFGAL_00394	nanD	Predicted sialic acid ABC transporter, permease component and ATP-binding component
	BIFGAL_00393	nanF	Predicted sialic acid ABC transporter, ATP binding component
	BIFGAL_00392	nanA	N-acetylneuraminate lyase (EC 2.5.1.56)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD