Regulon of NanR in Bifidobacterium breve DSM 20213

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFBRE_01963
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Sialic acid utilization
Effector:	Sialic acid
Regulog:	NanR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - GntR/Others
By effector - Sialic acid
By pathway - Sialic acid utilization

Regulated operons
	Locus Tag	Name	Function
Position: -149 Score: 5.5 Sequence: ATAAGTTGTCTGATGTCTTAA Position: -42 Score: 5.8 Sequence: ATCAGACATCAGATGTCATAT Locus tag: BIFBRE_01954 Name: nanB Funciton: Predicted sialic acid ABC transporter, solute binding component Locus tag: BIFBRE_01955 Name: nanC Funciton: Predicted sialic acid ABC transporter, permease component Locus tag: BIFBRE_01956 Name: nanD Funciton: Predicted sialic acid ABC transporter, permease component and ATP-binding component Locus tag: BIFBRE_01957 Name: nanF Funciton: Predicted sialic acid ABC transporter, ATP binding component Locus tag: BIFBRE_01958 Name: nanA Funciton: N-acetylneuraminate lyase (EC 2.5.1.56) Locus tag: BIFBRE_01959 Name: nagB2 Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	BIFBRE_01954	nanB	Predicted sialic acid ABC transporter, solute binding component
	BIFBRE_01955	nanC	Predicted sialic acid ABC transporter, permease component
	BIFBRE_01956	nanD	Predicted sialic acid ABC transporter, permease component and ATP-binding component
	BIFBRE_01957	nanF	Predicted sialic acid ABC transporter, ATP binding component
	BIFBRE_01958	nanA	N-acetylneuraminate lyase (EC 2.5.1.56)
	BIFBRE_01959	nagB2	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
Position: -36 Score: 6.3 Sequence: ATTGGACATCAGACGTCTGAT Locus tag: BIFBRE_01949 Name: SSF51658 Funciton: Xylose isomerase-like, TIM barrel domain Locus tag: BIFBRE_01950 Name: nanK Funciton: N-acetylmannosamine kinase (EC 2.7.1.60)
	BIFBRE_01949	SSF51658	Xylose isomerase-like, TIM barrel domain
	BIFBRE_01950	nanK	N-acetylmannosamine kinase (EC 2.7.1.60)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD