Regulog BL0185 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | 6 | 3 |
| Bifidobacterium angulatum DSM 20098 | 6 | 3 |
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | 8 | 4 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | 9 | 5 |
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| BDP_0236 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -58 score = 6.08395 sequence = ATATTACAACGTTGTACAAA Site: position = -83 score = 5.35762 sequence = CATTTACAACGATGTACTAT Gene: BDP_0236: Glycoside hydrolase, family 43 |
|
*
Bifidobacterium longum NCC2705 Site: position = -62 score = 5.97869 sequence = AGTTTACATCGTTGTACAAA Gene: BL0183: Glycoside hydrolase, family 43 |
|
Glycoside hydrolase, family 43 |
| BL0182 |
|
|
|
|
|
|
|
|
Gene: BL0182: Glycoside hydrolase, family 43 |
|
Glycoside hydrolase, family 43 |
| CRON 2. | |||||||||||
| abfA2 |
|
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -49 score = 4.66833 sequence = TATATTCAACGTTGTAAATA Site: position = -72 score = 5.50869 sequence = TTGTTACAACGATGTAAGAA Gene: BAD_0152: Alpha-L-arabinofuranosidase |
*
Bifidobacterium angulatum DSM 20098 Site: position = -49 score = 4.66833 sequence = TATATTCAACGTTGTAAATA Site: position = -72 score = 5.56175 sequence = TTGTTACAACGTTGTAAGAA Gene: BIFANG_01258: Alpha-L-arabinofuranosidase |
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -50 score = 4.50259 sequence = TATATTCAACGTTGTAAATT Site: position = -73 score = 5.93895 sequence = TTTGTACAACGATGTAATAG Gene: BDP_0239: Alpha-L-arabinofuranosidase |
|
*
Bifidobacterium longum NCC2705 Site: position = -77 score = 5.54588 sequence = TTGTTACATCGTTGTACATC Site: position = -53 score = 5.00276 sequence = ATATTGCATCGATGTAAATA Gene: BL0187: Alpha-L-arabinofuranosidase |
|
Alpha-L-arabinofuranosidase |
| CRON 3. | |||||||||||
| BIFANG_01259 |
|
|
*
Bifidobacterium angulatum DSM 20098 Site: position = -114 score = 5.11564 sequence = AAATTACAACGTTATAAAAG Site: position = -146 score = 5.68366 sequence = CTTGTACAACGATAGAAAAA Gene: BIFANG_01259: ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
ABC transporter, substrate-binding protein |
| BIFANG_01260 |
|
|
Gene: BIFANG_01260: ABC-type sugar transporter, permease component |
|
|
|
|
|
|
|
ABC-type sugar transporter, permease component |
| BIFANG_01261 |
|
|
Gene: BIFANG_01261: ABC-type sugar transporter, permease component |
|
|
|
|
|
|
|
ABC-type sugar transporter, permease component |
| CRON 4. | |||||||||||
| BAD_0149 |
|
*2
Bifidobacterium adolescentis ATCC 15703 Site: position = -72 score = 6.27034 sequence = GTTGTACAACGATGTAAAAC Site: position = -47 score = 5.92418 sequence = ATAGTACATCGTTGTAAAAC Gene: BAD_0146: Glycoside hydrolase, family 43 Gene: BAD_0149: Glycoside hydrolase, family 43 |
*
Bifidobacterium angulatum DSM 20098 Site: position = -43 score = 4.9777 sequence = ATAATACATCGATGTAAATC Site: position = -69 score = 5.96147 sequence = GCTGTACAACGATGTAAAAA Gene: BIFANG_01256: Glycoside hydrolase, family 43 |
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -44 score = 5.35762 sequence = ATAGTACATCGTTGTAAATG Site: position = -69 score = 6.08395 sequence = TTTGTACAACGTTGTAATAT Gene: BDP_0237: Glycoside hydrolase, family 43 |
|
*
Bifidobacterium longum NCC2705 Site: position = -73 score = 5.97869 sequence = TTTGTACAACGATGTAAACT Gene: BL0184: Glycoside hydrolase, family 43 |
|
Glycoside hydrolase, family 43 |
| BL0185 |
|
Gene: BAD_0150: Transcriptional regulator of carbohydrate utilization, LacI family |
Gene: BIFANG_01257: Transcriptional regulator of carbohydrate utilization, LacI family |
|
|
|
Gene: BDP_0238: Transcriptional regulator of carbohydrate utilization, LacI family |
|
Gene: BL0185: Transcriptional regulator of carbohydrate utilization, LacI family |
|
Transcriptional regulator of carbohydrate utilization, LacI family |
| CRON 5. | |||||||||||
| Blon_2061 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -170 score = 5.94134 sequence = TTTGTACAACGATAGAAAAA Gene: BDP_0240: ABC-type sugar transporter, sugar-binding component |
|
|
|
ABC-type sugar transporter, sugar-binding component |
| BDP_0241 |
|
|
|
|
|
|
Gene: BDP_0241: ABC-type sugar transporter, permease component |
|
|
|
ABC-type sugar transporter, permease component |
| BDP_0242 |
|
|
|
|
|
|
Gene: BDP_0242: ABC-type sugar transporter, permease component |
|
|
|
ABC-type sugar transporter, permease component |
| BDP_0243 |
|
|
|
|
|
|
Gene: BDP_0243: Glycosyl hydrolase family 43 |
|
|
|
Glycosyl hydrolase family 43 |
| CRON 6. | |||||||||||
| BL0186 |
|
|
|
|
|
|
|
|
*
Bifidobacterium longum NCC2705 Site: position = -207 score = 5.54588 sequence = GATGTACAACGATGTAACAA Site: position = -65 score = 4.72962 sequence = GAATTACAACGTTATAATGA Site: position = -231 score = 5.00276 sequence = TATTTACATCGATGCAATAT Gene: BL0186: possible esterase |
|
possible esterase |
| CRON 7. | |||||||||||
| BAD_0153 |
|
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -267 score = 4.69328 sequence = AAATTACAACGTTGAAAATA Site: position = -299 score = 5.83463 sequence = GTTGTACAACGATAGAAAAA Gene: BAD_0153: ABC-type sugar transport systems, substrate-binding components |
|
|
|
|
|
|
*
Bifidobacterium longum NCC2705 Site: position = -175 score = 4.88295 sequence = GAATTCCAACGTTGTAAACG Site: position = -205 score = 6.12966 sequence = TTTGTACAACGATGGAAAAC Gene: BL0188: ABC-type sugar transport systems, substrate-binding components |
|
ABC-type sugar transport systems, substrate-binding components |
| BAD_0154 |
|
Gene: BAD_0154: ABC-type sugar transport systems, permease components |
|
|
|
|
|
|
Gene: BL0189: ABC-type sugar transport systems, permease components |
|
ABC-type sugar transport systems, permease components |
| BAD_0155 |
|
Gene: BAD_0155: ABC-type sugar transport systems, permease components |
|
|
|
|
|
|
Gene: BL0190: ABC-type sugar transport systems, permease components |
|
ABC-type sugar transport systems, permease components |
| bglS |
|
Gene: BAD_0156: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
|
|
|
|
|
Beta-glucosidase (EC 3.2.1.21) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |