Regulon of BL0185 in Bifidobacterium adolescentis ATCC 15703

Properties
Regulator type:	Transcription factor
TF locus tag:	BAD_0150
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BL0185 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 6.3 Sequence: GTTGTACAACGATGTAAAAC Position: -47 Score: 5.9 Sequence: ATAGTACATCGTTGTAAAAC Locus tag: BAD_0146 Name: null Funciton: Glycoside hydrolase, family 43
	BAD_0146		Glycoside hydrolase, family 43
Position: -299 Score: 5.8 Sequence: GTTGTACAACGATAGAAAAA Position: -267 Score: 4.7 Sequence: AAATTACAACGTTGAAAATA Locus tag: BAD_0153 Name: null Funciton: ABC-type sugar transport systems, substrate-binding components Locus tag: BAD_0154 Name: null Funciton: ABC-type sugar transport systems, permease components Locus tag: BAD_0155 Name: null Funciton: ABC-type sugar transport systems, permease components Locus tag: BAD_0156 Name: bglS Funciton: Beta-glucosidase (EC 3.2.1.21)
	BAD_0153		ABC-type sugar transport systems, substrate-binding components
	BAD_0154		ABC-type sugar transport systems, permease components
	BAD_0155		ABC-type sugar transport systems, permease components
	BAD_0156	bglS	Beta-glucosidase (EC 3.2.1.21)
Position: -72 Score: 5.5 Sequence: TTGTTACAACGATGTAAGAA Position: -49 Score: 4.7 Sequence: TATATTCAACGTTGTAAATA Locus tag: BAD_0152 Name: abfA2 Funciton: Alpha-L-arabinofuranosidase
	BAD_0152	abfA2	Alpha-L-arabinofuranosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD