Regulon of BL0185 in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_0238
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BL0185 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	8
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -83 Score: 5.4 Sequence: CATTTACAACGATGTACTAT Position: -58 Score: 6.1 Sequence: ATATTACAACGTTGTACAAA Locus tag: BDP_0236 Name: null Funciton: Glycoside hydrolase, family 43
	BDP_0236		Glycoside hydrolase, family 43
Position: -69 Score: 6.1 Sequence: TTTGTACAACGTTGTAATAT Position: -44 Score: 5.4 Sequence: ATAGTACATCGTTGTAAATG Locus tag: BDP_0237 Name: null Funciton: Glycoside hydrolase, family 43 Locus tag: BDP_0238 Name: BL0185 Funciton: Transcriptional regulator of carbohydrate utilization, LacI family
	BDP_0237		Glycoside hydrolase, family 43
	BDP_0238	BL0185	Transcriptional regulator of carbohydrate utilization, LacI family
Position: -170 Score: 5.9 Sequence: TTTGTACAACGATAGAAAAA Locus tag: BDP_0240 Name: null Funciton: ABC-type sugar transporter, sugar-binding component Locus tag: BDP_0241 Name: null Funciton: ABC-type sugar transporter, permease component Locus tag: BDP_0242 Name: null Funciton: ABC-type sugar transporter, permease component Locus tag: BDP_0243 Name: null Funciton: Glycosyl hydrolase family 43
	BDP_0240		ABC-type sugar transporter, sugar-binding component
	BDP_0241		ABC-type sugar transporter, permease component
	BDP_0242		ABC-type sugar transporter, permease component
	BDP_0243		Glycosyl hydrolase family 43
Position: -73 Score: 5.9 Sequence: TTTGTACAACGATGTAATAG Position: -50 Score: 4.5 Sequence: TATATTCAACGTTGTAAATT Locus tag: BDP_0239 Name: abfA2 Funciton: Alpha-L-arabinofuranosidase
	BDP_0239	abfA2	Alpha-L-arabinofuranosidase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD