Regulon of BL0185 in Bifidobacterium angulatum DSM 20098

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFANG_01257
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BL0185 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 28 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -146 Score: 5.7 Sequence: CTTGTACAACGATAGAAAAA Position: -114 Score: 5.1 Sequence: AAATTACAACGTTATAAAAG Locus tag: BIFANG_01259 Name: null Funciton: ABC transporter, substrate-binding protein Locus tag: BIFANG_01260 Name: null Funciton: ABC-type sugar transporter, permease component Locus tag: BIFANG_01261 Name: null Funciton: ABC-type sugar transporter, permease component
	BIFANG_01259		ABC transporter, substrate-binding protein
	BIFANG_01260		ABC-type sugar transporter, permease component
	BIFANG_01261		ABC-type sugar transporter, permease component
Position: -72 Score: 5.6 Sequence: TTGTTACAACGTTGTAAGAA Position: -49 Score: 4.7 Sequence: TATATTCAACGTTGTAAATA Locus tag: BIFANG_01258 Name: abfA2 Funciton: Alpha-L-arabinofuranosidase
	BIFANG_01258	abfA2	Alpha-L-arabinofuranosidase
Position: -69 Score: 6 Sequence: GCTGTACAACGATGTAAAAA Position: -43 Score: 5 Sequence: ATAATACATCGATGTAAATC Locus tag: BIFANG_01256 Name: null Funciton: Glycoside hydrolase, family 43 Locus tag: BIFANG_01257 Name: BL0185 Funciton: Transcriptional regulator of carbohydrate utilization, LacI family
	BIFANG_01256		Glycoside hydrolase, family 43
	BIFANG_01257	BL0185	Transcriptional regulator of carbohydrate utilization, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD